1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irina1246 [14]
3 years ago
7

Primary and secondary air pollutants can co-exist in the atmosphere. a. True b. False

Biology
2 answers:
tiny-mole [99]3 years ago
5 0
True is your correct answer.
Neporo4naja [7]3 years ago
4 0
I believe this is A, true.
You might be interested in
Which two scientists proposed an atomic model with a nucleas
const2013 [10]

Answer:

Thomson and Rutherford

Explanation:

6 0
3 years ago
Read 2 more answers
A man with the autosomal recessive disorder phenylketonuria (PKU) and a woman without PKu heve a son named Peter, who does not h
Anton [14]

Answer:

<h2>2. Peter's maternal grandfather has PKU.</h2>

Explanation:

  • Such type of the genetic disorder in which two copies of a gene must be mutated at a time is called autosomal recessive disorder such as sickle cell anemia, phenylketonuria, and some other diseases.
  • When a sing copy of a gene is mutated in a person then this disorder is not appeared and the person is called a carrier.
  •  So when a child is born by two carrier parents then there is a chance that a child will be affected if both the parents donate mutated genes.
  • In the case of Peter, since peter does not show this defect this means his maternal grandfather was affected by this disorder.

5 0
3 years ago
Rainforest deforestation is contributing to _______.
Nana76 [90]
The correct answer is letter A.

Rainforest deforestation is contributing to a decline in global biodiversity. Irresponsible logging causes the major destruction of many habitats. As a result, many living organisms that are thriving within these forests are displaced or are killed because they no longer have any place where they can thrive and live in peace with their respective species. Deforestation accounts for most of the major catastrophic natural events that we are experiencing at present.
8 0
3 years ago
Read 2 more answers
PLEASE HELP
Hunter-Best [27]

Sorry if I am wrong

Answer:

Food is broken down into nutrients.

Skeletal system

Explanation:

6 0
2 years ago
Which of the following is a direct benefit of biodiversity?
IRISSAK [1]

improved soil fertility

Explanation:

One direct benefit of biodiversity is improved soil fertility. Biodiversity is the variety of plants and animals living in a particular ecosystem.

  A soli is made up of organic matter. Organic matter is the remain of dead and decaying plant and animal materials in the soil.

Organic matter is a very important soil component.

Since plants and animals eat up plants which takes nutrients from the soil, there must be a way to replenish these vital soil materials.

 The more biodiverse an ecosystem, the better its chance of adding more nutrients to the soil as they decay.

Learn more:

Biodiversity brainly.com/question/10723602

#learnwithBrainly

8 0
3 years ago
Other questions:
  • Since most personal watercraft (pwc) do not have brakes, what must be done in order to avoid an obstacle?
    7·1 answer
  • Which relationship between the two species listed would be mutually beneficial?
    5·1 answer
  • What happens to the amount if available to the amount of energy in the pyramid as it moves up through different levels?
    12·1 answer
  • Acupuncture is an alternative medicine that uses wire-thin needles inserted by a trained practitioner into specific points in th
    15·2 answers
  • What is a specialized species
    8·1 answer
  • Need help ASAP:( What is the relationship among evolutionary mechanisms and genetic diversity?
    15·1 answer
  • Which of the following is not considered an environmental impact of geothermal energy? A) gas emissions B) disturbance of the la
    14·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • Groups of specilized cells working together are called
    11·1 answer
  • Original DNA Sequence:<br> TACACCTTGGC GACGACT<br> mRNA Sequence:<br> Amino Acid Sequence:
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!