1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
a_sh-v [17]
3 years ago
15

Looking at the chemical reaction provided here, propose a different method that could be used to measure amylase activity: Starc

h + H2O = maltose
Biology
1 answer:
Anna007 [38]3 years ago
3 0

Answer:

Starch + H2O = maltose

This reaction gives the Starch and H2O as the reactants and Maltose as the product.

Amylase is an enzyme which helps in the digestion of Starch molecules and its activity can however be measured through careful monitoring of the disappearance of amylase substrate which is in this case, starch.

You might be interested in
Polisakarida merupakan gula polimer yang terbentuk melalui proses kondensasi. Beratus-ratus
Sholpan [36]

Answer:

aa

Explanation:

6 0
3 years ago
Prokaryotic cells have _____ DNA than eukaryotic cells and _____ chromosomes.
Yuri [45]

The answer for this question I will say is LESS and CIRCULAR.

https://answers.yahoo.com/question/index?qid=20081120175341AAMbjhd

Prokaryotic cells are usually smaller and simpler than eukaryotic cells. They do not have a nucleus or other membrane-bound organelles. In prokaryotic cells, the DNA, or genetic material, forms a single large circle that coils up on itself.

here is some information if you need more evidence follow the link and read the paragraph above!! I hope this helps you a lot!!!

3 0
3 years ago
Read 2 more answers
A Chlorella cell viewed through a microscope is 0.00005 m wide when the magnification is 2000.
juin [17]

Answer:

0.0025micrometer.

Explanation:

To calculate the actual size of the image, the formula to be used is

Actual size=Image size÷magnification.

The image size is 0.00005 wide

Magnification is 2000

First, convert the image size to micrometer.

=0.00005 × 1000000

50micrometers.

Actual size= 50÷2000

Actual size = 0.0025

3 0
3 years ago
Golgi apparatus is to vacuole as packaging is to
amid [387]
Storage.  Vacuoles store water and waste.
4 0
3 years ago
(Answer here) is a high energy molecule, while (Answer here) is the low energy version of that molecule
allochka39001 [22]

Answer:

First blank: atp

Second blank: adp

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • Is viruses simple or complex
    12·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Horses and donkeys can interbreed, but their offspring (mules) are infertile. This is an example of what kind of reproductive is
    9·1 answer
  • Emily writes on both sides of her paper at school. her family also recycles newspapers at home. which natural resource is emily
    14·1 answer
  • Compare positive and negative feedback mechanisms
    14·2 answers
  • Which age related change can cause nocturia? decreased ability to concentrate urine decreased production of antidiuretic hormone
    12·1 answer
  • Adding sodium to chlorine gas will produce table salt.
    14·1 answer
  • Help me please!<br><br>Cystic Fribrosis...<br><br><br>.​
    15·1 answer
  • 4. In science, most concepts are related to other concepts. Which of the following is most closely related to the Law
    9·1 answer
  • All of the following are true of surveying except
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!