1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
4 years ago
7

What does the principle of faunal succession state

Biology
2 answers:
Eddi Din [679]4 years ago
7 0

The principle of faunal succession states that fossil, animal and plant groups occur in the geological record according to an invariable and determined order, so that, if this order is known, it is possible to determine the relative age of the layers from their fossiliferous content. That is, according to this principle, fossil is equal to time. This principle was initially used as a practical instrument, but years later was explained by Darwin's theory of evolution: Since there is an irreversible biological evolution across geological time, fossils must be ordered in time on an evolutionary scale.

Shtirlitz [24]4 years ago
4 0
The principle of faunal succession<span>, also known as the law of </span>faunal succession<span>, is based on the observation that sedimentary rock strata contain fossilized flora and fauna, and that these fossils succeed each other vertically in a specific, reliable order that </span>can<span> be identified over wide horizontal distances.</span>
You might be interested in
Someone please help me
umka2103 [35]

Answer:

mass and volume

Explanation:

Matter is anything that has mass and takes up space

8 0
3 years ago
Read 2 more answers
When the brain is unoccupied, an fmri indicates that blood continues to flow via a web of brain regions called the?
bulgar [2K]

Default network


When the brain is unoccupied, an fMRI indicates that blood continues to flow via a web of brain regions called the default network.

The default network is a web of brain regions that have activity that corresponds greatly with each other and different from other networks within the brain. The default network is active when an individual's attention is not concentrated on the external environment and it is measured with the functional magnetic resonance imaging technique (fMRI).



7 0
3 years ago
Which tissue forms coverings, linings, and glands
Vedmedyk [2.9K]
I believe it is Epithelial Tissue. <span />
4 0
3 years ago
Read 2 more answers
The gastric phase of gastric secretion is triggered by the:
Anvisha [2.4K]

Answer:

The entry of food into the stomach.

Explanation:

Gastric secretion is triggered by the act of eating which is called as reflex phase and the entry of food into the stomach called a gastric phase. The entry of the food particles into the small intestine also helps to control the secretion of gastric called an intestinal phase.

The secreted fluid in the small intestine contains some ions, acids, etc such as pepsinogen, intrinsic factor, bicarbonate, hydrochloric acid, and mucus. The reflex phase or cephalic phase helps to stimulate parasympathetic neurons that release acetylcholine chemical, then it produces the higher secretion of gastric juice.

6 0
4 years ago
This type of endocytosis is the cellular process of engulfing liquid particles by the cell membrane.
Natalija [7]

The correct answer is Phagocytosis type of endocytosis is the cellular process of engulfing liquid particles by the cell membrane.

Phagocytosis is a type of endocytosis in which large particles such as microorganisms and dead cells are ingested through large endocytic vesicles known as phagosomes. Phagocytosis is the process of detecting and absorbing particles larger than 0.5 m in size. The particle is internalized into the phagosome, a distinct organelle. This phagosome then undergoes phagosome maturation, which involves changing the structure of its membrane and the composition of its contents. The first step is to activate the phagocyte.

Step 2: Phagocyte Chemotaxis (for wandering macrophages, neutrophils, and eosinophils)...

Step 3: Phagocyte attachment to the Microbe or Cell.

Step 4: The Phagocyte consumes the microbe or cell.

Learn more about Phagocytosis here :-

brainly.com/question/11667538

#SPJ4

7 0
1 year ago
Other questions:
  • Prior to working at a vita/tce site, all vita/tce volunteers (greeters, client facilitators, tax preparers, quality reviewers, e
    6·1 answer
  • What is the density of a 75 g cube measuring 4 cm on each side
    12·1 answer
  • The Coriolis effect contributes to ________.
    13·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • I need help please someone please
    11·1 answer
  • Which statement best describe the difference between a gene and an allele
    13·2 answers
  • Where do echinoderms live?
    13·2 answers
  • Which pathway is generally followed by a protein produced for secretion? select one:
    15·1 answer
  • ?!??!?!??! pls help giving brianliest !
    15·2 answers
  • The Dub in “lub dub” is the closing of the ____________________ and _____________ valves because pressure in the arteries is gre
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!