1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
weeeeeb [17]
3 years ago
11

Kelsy contracted an infection caused by a pathogen from the genus Trichophyton. Her doctor gave her a medicated cream to rub on

the area and told her to keep it as dry as possible.
Biology
2 answers:
Gennadij [26K]3 years ago
8 0
<span>athlete’s foot, an itchy foot rash caused by a fungus</span>
const2013 [10]3 years ago
5 0

Answer: Trichophyton is a fungus

Explanation:

Trichophyton is a genus of fungi which includes the parasite varieties which causes tinea including the athlete foot, ringworm, itching.

The fungus have the characteristic feature to grow in a moist area. The person is having an anti fungal tube which is being applied to the area where the fungal infection is present.

It is advised to keep the area clean and dry because the moist place allows the growth of more fungus.

You might be interested in
What skills do scientists use as they investigate scientific questions?
Serhud [2]
The scientific method
a process used by scientist to investigate questions. It is a series of steps that allow scientist to meaningful experiments in an organized way.1)observe and ask questions. 2)form hypothesis.3)plan an experiment.4)conduct(do) the experiment 5)draw conclusions
8 0
3 years ago
Consider the table.
nika2105 [10]

Answer:

x is spherical.... y is e.colii

Unlike the lysogenic cycle, the lytic cycle involves destruction of the host.

5 0
3 years ago
4. What domain name should replace the question mark in this chart?
Semmy [17]

Answer:

C. Eukarya

Explanation:

3 0
3 years ago
a) ¿Qué utensilios de uso común y pensando en la contingencia sanitaria, podrían ser elaborados del cobre?
forsale [732]

Answer:

Hierro fundido.

Acero inoxidable.

Vidrio.

Bambú.

Cerámico.

quizás

Explanation:

4 0
3 years ago
What is the best time for the removal of weeds .​
vagabundo [1.1K]

Answer:

The best time to remove weeds is when the soil is damp and moist. The day after it has rained is a great day for weeding. Damp soils are loose and make it easier to remove them with their roots. Otherwise, you may run the risk of leaving the roots because they are stuck in the soil.

4 0
4 years ago
Read 2 more answers
Other questions:
  • Because it is believed the hormone insulin is dependent upon chromium for optimal activity, one of the chief functions of chromi
    14·1 answer
  • Plant roots help hold soil together. how can shrub and tree branches also help hold soil together?
    5·1 answer
  • A major connection for sugars in glycolysis is ________.
    14·1 answer
  • Epimysium Select one: a. surrounds individual muscles. b. separates muscle fibers. c. connects muscles to bone. d. is a type of
    8·2 answers
  • Which structure produces and organizes the proteins that form the spindle fibers
    12·1 answer
  • Summarize the concepts of carrying capacity and limiting factors.​
    13·1 answer
  • transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
    7·1 answer
  • 4. Def
    9·1 answer
  • PLZZZ AWNSER QUICK I WILL GIVE BRAINLIEST TO WHOEVER AWNSERS RIGHT
    9·2 answers
  • Following a lengthy marathon, a runner feels out of breath and is experiencing muscle soreness. Explain
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!