1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Karolina [17]
3 years ago
9

Other than their respective systems, what other system could the lungs and skin be classified as members of? Why this system?

Biology
1 answer:
Gnoma [55]3 years ago
4 0
Lungs and skin can also be part of the excretory system due to fact that they both excrete wastes.
Skin secretes excess water and salts
Your lungs help you get rid of waste gases
You might be interested in
Which occurrence represents an example of evolution
vladimir1956 [14]
Herbivory, having animals develop to eat plants is an <span>occurrence  that represents an example of evolution.</span>
5 0
3 years ago
What is the purpose of the nuclear membrane? Why is it important?
jenyasd209 [6]
This is where genetic material, or DNA, is stored,<span> The pores regulate the passage of macromolecules like proteins and RNA, but permit free passage of water, ions, ATP and other small molecules.</span>
8 0
4 years ago
1)How many years of history separate 1200 B.C. and A.D. 450?
olga nikolaevna [1]
C 1650 Because you have to factor in the difference of BC and AD. you must get 1200 BC to 0 first, and then go to 450, therefore getting 1650 
8 0
3 years ago
Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
Tomtit [17]

Answer:

I'll break this into threes so its easier to read;

TTC ATG CTA GCT ACG TGT ACG TAC CGA TGC G

Explanation:

In DNA, the A bases goes with the T bases, and the C bases go with the G bases.

3 0
4 years ago
vanessa had been advised not to use pesticides that will harm the bees in the orchards.suggest one reason why it is important fo
jasenka [17]

Answer:

Pesticides vary in their effects on bees. Contact pesticides are usually sprayed on plants and can kill bees when they crawl over sprayed surfaces of plants or other areas around it. ... When a bee comes in contact with pesticides while foraging, the bee may die immediately without returning to the hive.

8 0
3 years ago
Other questions:
  • The carbon cycle describes how carbon moves through the which of the following spheres? Select all that apply.
    10·2 answers
  • In a population of deer in one year six deer were born five deer emigrated three deer were killed by predators and one deer immi
    14·2 answers
  • Can you help me on these?
    9·1 answer
  • Which water-saving technology is aimed at limiting water loss in the home?
    9·2 answers
  • Where does transcription occur in a cell?
    7·2 answers
  • Which checkpoint requires a cell to be of adequate size in order to move to the next phase in the cell cycle? G1/S checkpoint G2
    9·2 answers
  • Why are olive ridley turtles vulnerable?
    12·1 answer
  • Choose all the answers that apply. Extrusive igneous rocks _____. form on the surface form below the Earth's crust cool quickly
    10·2 answers
  • Help asap plss giving branlist
    11·1 answer
  • Please help! After 1973, American scientists began to make serious efforts to develop technologies that create
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!