1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sammy [17]
3 years ago
14

Piz help me fast!!!! thx​

Biology
2 answers:
pentagon [3]3 years ago
5 0

Answer: B fatty acids

Explanation:

Inga [223]3 years ago
3 0

Answer: I think it is C

Explanation:

You might be interested in
What type of reasoning is used in this example?
brilliants [131]
<h2>Answer:</h2>

The reasoning used is <u>inductive reasoning</u>.

<h2>Explanation:</h2>

The type of reasoning where the examples are used to derive conclusion it is called as inductive reasoning. The end is the theory or plausible. This implies the end is the piece of thinking that inductive thinking is attempting to demonstrate. Inductive thinking is likewise alluded to as 'circumstances and logical results thinking' or 'base up thinking' since it looks to demonstrate an end first. This is normally gotten from explicit occasions to build up a general end.

As the given examples quotes many examples of desert and then derives conclusion out of it, this is considered as example of inductive reasoning.

8 0
3 years ago
what would happen to an enzyme if the temperature and pH changed significantly beyond the enzyme`s optimum level?
allochka39001 [22]
<span>If the PH and temperature changed significantly beyond the enzyme optimum level it will become denatured and then the enzyme would not work.
The Enzyme is a biological catalyst which speeds up a reaction. The Enzyme has molecules which act upon as substrates and then it converts those substrates into different molecules which are called products.
The study of the enzyme is known as enzymology, and they are well known to catalyze more than 5,000 biochemical reaction types.</span>
6 0
3 years ago
What might happen to the sea star population after oyster beds are destroyed
WINSTONCH [101]
Sea stars (or starfish) feed off the oyster beds. If the oyster beds were destroyed it would deplete the major food source of the sea stars and they would begin to diminish.
6 0
3 years ago
Why is VRBA (Violet red bile agar) only pasteurized rather than sterilized prior to use?
Georgia [21]

Answer:

Explanation:

This is because Violet and red bike is only a selective medium that detect and analyse lactose coliform microorganisms that cause fermentation and this is present in diary products like milk. This is milk use for microbiological analysis of milk because of it ability to detect lactose which is a milk sugar. There fore it cannot be use for sterilization.

4 0
3 years ago
A channel that opens in response to the binding of a specific molecule, which is usually NOT the solute that passes through the
gogolik [260]

Answer: Ligand gated channel

Explanation:

Ligand gated channel is an essential membrane protein that has pores and allows the passage of specific ions across the plasma membrane when it is activated by a specific chemical . Examples of such ions that pass through Ligand gated channels are Sodium ions, Potassium ions, Calcium ions. Ligand gated channels are found in extensions of the nerve cells.

4 0
3 years ago
Other questions:
  • The concentration of na within a cell is required to be __ than the external concentration.
    11·1 answer
  • Originally ,scientists classified organisms into five kingdoms based in part on _____ structure A) cell B) family C) organ
    6·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • A client suffers from low mood and disturbed sleep. this client is most likely experiencing a change in which neurotransmitter?
    7·1 answer
  • Turning off these genes ca cause less mature cells to divide too rapidly.What could this lead to the development of
    7·1 answer
  • How do microorganisms eliminate harmful material?
    15·1 answer
  • What did the student do wrong in constructing this graph?
    8·1 answer
  • What is recombinant plasmid
    14·1 answer
  • isaac is investigating how long it takes his dog to react to different sounds. what is the independent variable?
    10·1 answer
  • Pls answer
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!