1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Advocard [28]
3 years ago
15

Which atom has two unpaired electrons in the outer valence

Biology
1 answer:
natulia [17]3 years ago
3 0

Answer:

Oxygen

Explanation:

The electrons present in an atom are arranged in shells or orbitals. The electrons are filled into these shells based on their energy levels with those shells closest to the nucleus filled first as they have the lowest energies.

The arrangement of electrons around the nucleus of an atom is known as electronic configuration. The outermost electron shell of an atom is known as a valence shell shell and the electrons found in this shell are known as valence electrons. The electrons usually exist in pairs. The first shell can only contain two electrons; the second shell can contain 8. the electrons are singly filled first before pairing occurs.

The electronic configuration of the atoms of the elements in the option are as follows:

Helium : 1s² ; valence electrons are 2 which are both paired

Hydrogen: 1s¹ ; valence electron is 1

Oxygen : 1s²2s²2p⁴ ; valence electrons are 6 wit two unpaired electrons

Lithium : 1s²2s¹ ; valence electron is 1

Helium has two valence electrons but they are paired as its 1s shell can only contain a maximum of two electrons.

Oxygen has 6 valence electrons. Two of these electrons are paired <em>while the other two are unpaired.</em>

You might be interested in
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
What do the cell walls of plants and the extracellular matrix of animal cells have in common?
Tasya [4]

here you go

Explanation:

What do the cell walls of plants and the extracellular matrix of animal cells have in common? They have functional connections with the cytoskeleton inside the cell.

7 0
3 years ago
How does temperature affect water availability in an ecosystem?
andrew11 [14]
H20 tends to evaporate quicker in 80 degrees or higher, evaporation in colder weather, is much slower.
8 0
2 years ago
The nervous system and the muscle system responds to stimuli to produce motion. The movements of
evablogger [386]

Answer:

skeletal

Explanation:

skeletal bones are involuntary

4 0
2 years ago
An individual who is establishing a strategy to use in order to accomplish a goal is demonstrating which phase of the self-regul
qwelly [4]

Answer:

Forethought

Explanation: Basically means planning ahead of time in order to know what to do when you are faced in a situation or event that will happen in the future

7 0
3 years ago
Other questions:
  • Which sentences describe the discipline of the natural science
    7·1 answer
  • After the aswan high dam was built on the nile river, the rate of parasitic worm infection doubled in the human population near
    6·2 answers
  • What is the cuplike depression of the hip bone into which the head of the femur fits?
    6·1 answer
  • Farming has greatly reduced the amount of virgin forest in the US.<br><br> True or False
    12·2 answers
  • Does your blood absorb all the oxygen you take into your lungs? Why or why not?
    10·1 answer
  • How can mutation in a gene lead to a new trait in an organism ?
    8·2 answers
  • _____ classifications suffer from problems of convergent and parallel evolution.
    15·1 answer
  • Which solid waste has the highest percentage in terms of not being recycled?
    14·2 answers
  • What is gained from each part of aerobic respiration?
    5·1 answer
  • What is skeletal system?<br>​
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!