1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Blizzard [7]
2 years ago
5

What would happen to the ecosystem when a keystone species, such as a wolf, is removed

Biology
1 answer:
andrew-mc [135]2 years ago
5 0
This would affect the population of the rabbits isf this happens the increase of population on the rabbits then if theres an increase on the rabiits then there will be a limiting factor of food for them this will affect the carraying capacity of the ecosystem
You might be interested in
Which of the following areas in a secondary lymphoid organ allows intimate contact between blood and the lymphocytes?
VLD [36.1K]
The answer is White pulp of the spleen
5 0
3 years ago
Members of the same species found in an ecosystem are called a -
NeTakaya

Members of the same species found in an ecosystem are called a

B: population

6 0
3 years ago
Read 2 more answers
Ritika observes that her father before storing the grains always dries them
Lunna [17]
D so that bacteria doesnt multiply in the grains since moisture favours them
7 0
2 years ago
Read 2 more answers
Transcribe the following DNA strand: GATACA
eduard
CTATGT IS THE ANSWER
8 0
3 years ago
Essays need as least 5 or more sentences .
sertanlavr [38]

2) The stars that will most likely be habitable or suitable for life are stars similar to the sun, a main sequence star like a yellow dwarf. In astronomy and astrobiology, the circumstellar habitable zone (CHZ), or simply the habitable zone, is the range of orbits around a star within which a planetary surface can support liquid water given sufficient atmospheric pressure.

<em><u>Hope this helps </u></em>(╹◡╹)

7 0
3 years ago
Other questions:
  • The waste from which type of power plant produces the least amount of greenhouse gases?
    7·1 answer
  • To report a code for hepatic capillariasis, the coder would report _____.
    12·1 answer
  • What are mutations?
    12·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Which could describe the motion of an object?
    6·2 answers
  • If a male genotype is Tt and the female genotype is TT, then what are the phenotypic ratios for tall and short corn?
    15·1 answer
  • Please help i do not understand
    13·2 answers
  • Help!
    7·2 answers
  • Which trophic level in a food web contains the most energy?.
    10·1 answer
  • Help me NOW 100 points and I will make you a brainlest!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!