1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mila [183]
2 years ago
12

A student finds the slope of the line between (8, 17) and (1, 4). She writes . What mistake did she make?

Biology
1 answer:
Zolol [24]2 years ago
6 0
Slope: \frac{y_2-y_1}{x_2-x_1} where --
                    (8, 17) = (x_1, ~y_1)
                    (1, 4) = (x_2,~y_2)

Slope = 13/7
You might be interested in
The DNA in eukaryotic cells is in the ...
vfiekz [6]

Explanation:

In eukaryotic cells, most DNA is located in the cell nucleus (though some DNA is also contained in other organelles, such as in the mitochondria and the chloroplast in plants). Nuclear DNA is organized into linear molecules called chromosomes

5 0
3 years ago
Which is a process that allows scientists to compare rock layers with others in a sequence to determine their age?
earnstyle [38]
Relative dating is the process
7 0
3 years ago
How do polar and nonpolar regions assist the membrane in regulation ​
Katarina [22]
Molecules that are hydrophilic (water loving) are capable of forming bonds with water and other hydrophilic molecules. They are called polar molecules. ... Small, nonpolar molecules (ex: oxygen and carbon dioxide) can pass through the lipid bilayer and do so by squeezing through the phospholipid bilayers.
8 0
2 years ago
Read 2 more answers
Which nerve is responsible for hiccups?
valkas [14]

Answer:

b. Phrenic nerve

Explanation: is correct

8 0
2 years ago
Read 2 more answers
15. Which of the processes has more than one type of RNA involved?
erastova [34]

Answer:

Translation

Explanation:

Translation is the process by which mRNA is decoded and translated to produce a polypeptide sequence, otherwise known as a protein. This method of synthesizing proteins is directed by the mRNA and accomplished with the help of a ribosome, a large complex of ribosomal RNAs (rRNAs) and proteins. In translation, a cell decodes the mRNA’s genetic message and assembles the brand-new polypeptide chain. Transfer RNA, or tRNA, translates the sequence of codons on the mRNA strand. The main function of tRNA is to transfer a free amino acid from the cytoplasm to a ribosome, where it is attached to the growing polypeptide chain. tRNAs continue to add amino acids to the growing end of the polypeptide chain until they reach a stop codon on the mRNA. The ribosome then releases the completed protein into the cell.

5 0
2 years ago
Other questions:
  • Please help will give brainliest asap
    5·2 answers
  • You can probably find algae
    11·2 answers
  • Which like forms would have been among the first organisms on earth
    7·1 answer
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What is a protein that catalyzes chemical reaction for organisms
    10·1 answer
  • Pls help me its for a text and i donr want to fail
    9·1 answer
  • What are the two harmful effects of microorganisms? ​
    6·2 answers
  • Do humans have an open or closed circulatory system? Explain.​
    10·1 answer
  • What ability listed below is unique to bats compared to all other mammals?
    8·1 answer
  • What is the meaning of science?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!