Answer:
d. transilluminate the mass
Explanation:
Sometimes, painless hard or tender mass develop in the scrotum of men and can cause testicular tumors.
After detecting a scrotal mass, to reduce the size of the mass, the next assessment required is to transilluminate the mass in which testicles will be appear opaque on transillumination. Transillumination of mass will help to detect the orientation of mass which can be treated further.
Hence, the correct answer is d. transilluminate the mass
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
Answer:
A person's mass will be the same on Jupiter and Earth, a person's weight will be greater on Jupiter than on Earth.
Explanation:
Mass is universal, meaning it can't change, but weight is used to measure how heavy something is, so, on a planet like Jupiter, since the gravity is more, you'll weigh more there.
