1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mekhanik [1.2K]
2 years ago
14

Explain the difference in the relative concentrations of oxygen and carbon dioxide in the blood vessels entering and leaving the

body organs
if someone could give me awnser to this i’ll give u brainliest
Biology
1 answer:
Readme [11.4K]2 years ago
8 0

Answer:

When entering, oxygen is high and carbon dioxide is being produced, when exiting carbon dioxide is being exhaled into the air

Explanation:

You might be interested in
Which would most likely be true in osteoporosis? osteoclast activity is high. osteoclast and osteoblast activity are normal. ost
Setler [38]
Its 8 please help me

5 0
3 years ago
Adding or removing heat from the system to change the temperature is an example of what kind of energy?
Viktor [21]
The answer is Thermal Energy
5 0
3 years ago
Read 2 more answers
Why have plants evolved ways to prevent self-fertlization? Why do you cross-fertilization (plant to plant) more beneficial to th
raketka [301]
2) Cross-fertilization makes for more variation in the traits of plants, giving them immunities and resistances to weather, pests, and disease.
6 0
3 years ago
Glucose is classified as a
In-s [12.5K]
Glucose<span> is by far the most common carbohydrate and </span>classified as a<span> monosaccharide </span>
8 0
3 years ago
Read 2 more answers
Which series correctly lists the eight taxonomic levels in order, from the broadest group to the most specific group?
AVprozaik [17]
Domain, kingdom, phylum, class, order, family, genus, species<span>
</span>
7 0
3 years ago
Read 2 more answers
Other questions:
  • Which two hormones are consistently related to high levels of aggression?
    15·1 answer
  • cells differentiation os critical during embryonic development the process of the cell differentiation results in the production
    6·1 answer
  • Need help ASAP im being timed North Dakota has the highest residential energy consumption, per capita, of any state in the US. N
    10·2 answers
  • Which of the following best compares rhizoids and fruiting bodies in Fungi?
    15·1 answer
  • Which method of classification requires that each taxonomic group be monophyletic
    6·1 answer
  • Which of the following parts of an organism is most likely to become fossilized?
    6·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What is punctuated equilibrium
    5·2 answers
  • I need the answer please
    15·1 answer
  • Which is the best description of the two organisms highlighted in orange?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!