1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ivanzaharov [21]
3 years ago
9

Giraffes with short necks lived in arid regions. Over time, grasses disappeared, forcing giraffes to eat from trees. Mutations i

n the genome led to some giraffes inheriting the trait for long necks. Over time, there were more giraffes with long necks in the region. What are the two reasons for the change in the population of giraffes?
Biology
2 answers:
pshichka [43]3 years ago
8 0
<h2>Answer:</h2>

The two reasons are given below:

  • Natural selection.
  • Lack of food
<h3>Explanation:</h3>

Natural selection is the phenomenon of the evolution in which the organisms able to fit in the changing environment survive while other organism died. Hence the survival if the fittest and then these organisms. Further reproduce to give birth organisms more fit to the changing environment.

The long neck giraffe survive but short neck died. So the population of long neck increased while short neck go extinct.

Other reason is the change of food resource. The food resource change from grass to long trees.

serg [7]3 years ago
6 0

Answer:

- adaptation

- natural selection

Explanation:

From the example of the Giraffes you can read that adaptation you can see that tehy adapted the lenght of their nexk in order to be able to reach food that was only available in the trees, so they had to make their necks longer, and then the giraffes that had the longest necks were the ones that were able to survive and get food, so they passed that treat to their offspring and with time only giraffes with longer necks were able to feed themselves, that´s natural selection.

You might be interested in
Senescence of the eyes is often demonstrated by the presence of
ludmilkaskok [199]

Answer: Senescent cells

The Senescence of the eyes is often demonstrated by the presence of <span>senescence cells. They are forms of cells that are normally capable of replication within mammalian tissues but permanently non-dividing and share features with oncogene-induced senescence. </span>Moreover, the accumulation of senescent cells has been overwhelmingly studied using fibroblasts and has been proposed to act as an ageing mechanism. 

4 0
4 years ago
What are the 2 types of building blocks for<br> lipids?
NISA [10]
The building blocks of lipids are one glycerol molecule and at least one fatty acid, with a maximum of three fatty acids.
Hope this helped you, and have an amazing day.
6 0
3 years ago
Which of the following provides evidence that all living things share common ancestors?
xxMikexx [17]

Answer:

a. All of these

Explanation:

All of these options are correct

5 0
3 years ago
D.SMALL INTESTINE 1. Name the building blocks of each major class of nutrients: complex carbohydrates (AKA polysaccharides like
Dima020 [189]

Answer:

Explanation:

1. Complex carbohydrates (AKA polysaccharides like starch)- monosaccharides linked together by glycosidic linkages

Fats (AKA triglycerides) - Fatty acids

Proteins- Amino acids.

2. Name the 3 portions of the small intestine in order - The Duodenum, Jejunum, and Ileum.

3. In which of these 3 portions does the greatest amount of nutrients absorption occur - Jejunum

6 0
3 years ago
What are the seven states that rely on the Colorado River as a water source?
Nookie1986 [14]
Those states would be Wyoming, Colorado, Utah, New Mexico, California, Arizona, And Nevada
The Upper Basin States being Wyoming Colorado Utah and New Mexico
The Lower basin states being Cali Az and Nevada
3 0
3 years ago
Other questions:
  • A plant grows faster and fuller due to large amounts of fertilizer. If the plant cross-pollinates with another plant later, how
    10·2 answers
  • Is erythematous a disease
    13·1 answer
  • The anatomy in the female genital system subsection starts with the vulva and progresses upward to the:
    8·1 answer
  • During ice ages our planet supports more glaciers and deserts than Forest<br><br>True or false?
    11·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • I need help with cell types gizmo<br>​
    5·1 answer
  • Which is an example of an ecosystem change that resulted from human activity?
    6·1 answer
  • The law that states rock layers closest to the surface are the newest or youngest rock is
    15·2 answers
  • Why is comparing cellular respiration to a burning fire a poor analogy
    7·1 answer
  • Reproduction in prokaryotes occurs primarily through the process known as
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!