1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
likoan [24]
3 years ago
13

A series of problem-solving procedures is called the

Biology
1 answer:
disa [49]3 years ago
4 0
D txhnichal proccess
You might be interested in
Which sequence represents the correct order of levels of organization found in a complex organism?
icang [17]

<u>Answer:</u>

C is the answer.

<u></u>

<u>Explanation:</u>

Organelles (the smallest in this situation) are what you can find inside a cell (example: nucleus, mitochondria, etc..).

Cells are what make up tissues (such as muscles).

Tissues make up organs (such as the heart) and organs make up organ systems (such as the circulatory system).

5 0
3 years ago
Need help fast!!!<br> please!! 20 POINTS
Vladimir79 [104]
Look it up online, look up a copy of the Articles of confederation and fill it in! Best I can do for you my friend
6 0
3 years ago
Read 2 more answers
Consider that fossils of Homo erectus dating between 1.66 and 1.85 mya have been found scattered across Eastern Europe through C
s344n2d4d5 [400]

Answer:

The correct option is option b that is<em> Homo erectus</em> is the common ancestor of<em> Homo neanderthalensis</em> and<em> Homo sapiens.</em>

Explanation:

<em>Homo erectus </em>appears about 2 mya, possibly during the Pleistocene  epoch and are considered as direct ancestor of human.They are called as upright man as they use legs for walking without any support.They are thought to be capable of doing certain things like hunting, starting fire,art making, create speech etc.

<em>Homo neanderthal</em> was the most recent ancestor species of modern human as they appear about 40,000 years ago.

They became extinct as they did't fight against environmental hazards and the major cause of their extinction that scientists have claimed that they did't adapt the modern techniques that the modern human does.

5 0
3 years ago
Do you think fracking is harmful or helpful explain why was two reasons
LenaWriter [7]

I think its harmful, because its unhealthy for workers and its harmful to the environment and to the people. Its also a waste of water and it pollutes the air.

hope that i helped and sorry if i was too late.

3 0
3 years ago
Is neocortex an active brain?​ and why?
Lostsunrise [7]

Answer:

Yes, The neocortex is the center for higher brain functions, such as perception, decision-making and language. Our group focuses on the mechanisms governing neocortex development, with a strong interest on the role and regulation of the neural stem cells.

Explanation:

6 0
3 years ago
Other questions:
  • How did the work of farmers and breeders in England influence the work of Charles darwin
    13·1 answer
  • The specific gravity of basalt is about
    11·1 answer
  • Why is meiosis important for
    6·1 answer
  • “I do not need to use a citation if I paraphrase because I put it in my own words.”
    15·2 answers
  • What name did Wegener give to the single large landmass composed of all continents?
    12·2 answers
  • 4.<br> Which is not a major mineral group?
    7·1 answer
  • Which theory directly
    10·1 answer
  • The “circle of life” can also be classified as a food <br> helppppp its a question
    11·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Which of these ideas correctly states a relationship between the practice of conserving energy and the effect that it has on peo
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!