All categories

2 years ago

Why are some countries in Oceania often grouped with Southeast Asia instead?

Geography

2 answers:

Tamiku [17]2 years ago

6 0

Answer:

There are two very different types of cultures in Oceania.

Explanation:

This is due to the fact they have as cultural similarities and thus are the same and are also close representatives of each other and most of them are considered to be a part of southeast Asia.

Most of these countries have various cultural and lifestyle similarities and thus groped with each other. Oceania has an areal extent of about 8,525,989 km square and a population of about 41,570,842.

<u>Earlier he the Philippines and the new guineas and present Indonesia formed Oceania.</u>

irga5000 [103]2 years ago

4 0

Some countries in Oceania often grouped with southeast Asia because : A. There is little diversity in Oceania
Culturally, the Oceania Region is really similar to the countries that exist in South East Asia.

You might be interested in

Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA

Rina8888 [55]

Answer:

Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0

2 years ago

What caused the increase in the number of latin america in the middle class in the late 19 century

exis [7]

One of the biggest reasons was that there were some revolutions that happened around the lat 19th century. They were primarily sparked by lower class individuals who were looking for more money to support themselves/families.

8 0

3 years ago

Give me your thoughts!!!!!

inn [45]

The long term effects of living poverty is that if there are children then they will be encouraged to go to school and make there life, and the life of there soon to come children, better. For generations, It come promote the children of the child to go to school and make money to get what they want.

Sorry that is so much, it is just my opinion.

7 0

3 years ago

Read 2 more answers

Which characteristic is most essential to a democratic society

Sunny_sXe [5.5K]

Answer:

A political system for choosing.

Explanation:

5 0

2 years ago

What advantage did railroads provide?

slamgirl [31]

It helped with faster transportation.

4 0

2 years ago