1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tangare [24]
3 years ago
8

Please Help I'll give brainliest!!!!!!!!!!

Biology
1 answer:
timofeeve [1]3 years ago
8 0
I feel like you're answer is b ☺ hopefully
You might be interested in
a few memebers of a population are immune to a diseise that kills many others they survive and reproduce wat is this an example
AlladinOne [14]
Survival Of Fit Individuals
5 0
3 years ago
Dogs are often purposely bred to assure certain desirable traits. What is this type of selective breeding?
siniylev [52]

Artificial selection is the type of selective breeding.

Selective breeding is process of breeding parents with distinct characteristics to produce offspring with more desirable characteristics.

Most of the time the breed of dogs were formerly selected for particular purposes, such as hunting or guarding which needs strong physical endurance. Hence, Selective breeding is evolved by human selection. For example racehorses, having particular traits are desirable in different breeds of dogs that compete in dog shows. Artificial selection, is selective breeding that is imposed by an selective process, in order to get the phenotype of desirable features.

To learn more about Artificial selection , here

brainly.com/question/12560443

#SPJ1

8 0
2 years ago
Please help me out!
Ilia_Sergeevich [38]
I believe it’s sex cells
7 0
3 years ago
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
3 years ago
Witch of the following is the most abundant source of carbohydrates?
Irina-Kira [14]
Please state the options / choices so that we can answer your question. Thank you.
3 0
3 years ago
Read 2 more answers
Other questions:
  • What could be a result of an injury to the dorsal column?
    7·2 answers
  • Carbon's valence is _____.<br> a. covalent<br> b. ionic<br> c. +4<br> d. -4
    8·1 answer
  • The differences between hashimotos' thyroiditis and grave's disease include
    5·2 answers
  • what happens when you get two cups of water and add one spoon of sugar and one spoon of black pepper ?
    15·1 answer
  • Which statement best explains why a karyotype can be used as a scientific report
    14·2 answers
  • 15 g of water were heated from 5 c to 25 C.if the specific heat of water is 4.2,about how much energy was added to the water
    15·1 answer
  • How are ionic and covalent bonds different from hydrogen bonds ?
    10·2 answers
  • An organism that produces its food by photosynthesis
    7·2 answers
  • 1. W pewnym małżeństwie zarówno mężczyzna, jak i kobieta mają grupę krwi AB. Podaj genotyp mężczyzny i kobiety, a następnie okre
    6·1 answer
  • The _____________ receives blood from the atrium and pumps it out of the heart.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!