1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
3 years ago
8

SOMEONE PLEASR HELP ME I SUCK AT DENSITY do both if possible :)

Biology
1 answer:
makvit [3.9K]3 years ago
6 0

Answer:

1. C

2. B

If I'm wrong sorry but overall I think those are the right answers.

You might be interested in
¿Cómo se produce la Hepatitis B?
guapka [62]

La hepatitis B es un virus, una infección de su hígado. Puede causar cicatrización del órgano, insuficiencia hepática y cáncer.

8 0
3 years ago
Which vertebrate group lays eggs and has feathers?
Soloha48 [4]
The bird group. iearjsnfklebf
4 0
4 years ago
Read 2 more answers
This week, we'll be exploring the process of photosynthesis, including investigating some critical plant components that enable
Tpy6a [65]

1) Carbon dioxide

The carbon atoms present in CO2 are used by the plant in the formation of the organic molecular group (sugar).

2) Chlorophyll

Photosynthetic pigments present in chloroplasts, responsible for absorbing light from wavelengths between blue and yellow and reflecting different shades of green

3) Oxygen

Oxygen is the end product of photosynthesis, the result of the breakdown process of water molecules.

4) Stomata

Stomates have the function of performing gas exchange between the plant and the external environment. This structure is also responsible for the perspiration of the plant.

5) Sunlight

Energy source for the process of transforming light energy into chemical energy

6) Glucose

Final product of photosynthesis. Molecule that will be used by the plant to maintain its vital functions.

7) Water

Oxygen source that will be released as a gas at the end of the process.

3 0
3 years ago
Which is not a function of a vacuole?
Citrus2011 [14]

they don't transport molecules

3 0
4 years ago
Bacteria growing in and on the human body, including normal microbiota as well as pathogens, are classified as __________.
Contact [7]
Mesophilic and heterotrophic 
4 0
4 years ago
Other questions:
  • What are the two specific steps where atp is used in glycolysis?
    9·1 answer
  • The illustration shows a type of fat. in which food listed below would you expect to find this type of fat?
    7·2 answers
  • Assessment of a term neonate at 8 hours after birth reveals tachypnea, diminished femoral pulses, and poor lower body perfusion.
    10·2 answers
  • poodle and a Labrador retriever can mate and have offspring. This means that these dogs ______. A. are in a different genus B. b
    14·1 answer
  • Why is the phrase "it's just a theory" misleading
    12·1 answer
  • Which of the following is carbon bonded
    9·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • Which vein is the only vein that carries oxygen-rich blood?.
    12·1 answer
  • Where are pesticides found in the environment?
    15·1 answer
  • The location of oxygen is represented by ___,
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!