1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
3 years ago
14

Please help with questions 7-12

Chemistry
1 answer:
Rufina [12.5K]3 years ago
3 0

Answer:

negitive 5 or -5

Explanation

usally 12-7 = 5 but 7 is first so it you turn 5 to negitive 5

or -5

You might be interested in
A hot metal plate at 150°C has been placed in air at room temperature. Which event would most likely take place over the next fe
Fantom [35]

Answer:

A

Explanation:

The molecules in both metal and surrounding air will start moving slower because of the sudden decrease in environment tmeperature. The thermal energy around the metal plate decreases, also decreasing the kinetic energy.

4 0
3 years ago
Which cannot be chemically broken down into simpler substances?
Anna71 [15]

Answer:

B.

Explanation:

elements

6 0
3 years ago
Read 2 more answers
Is the formation of acid rain an exothermic or endothermic reaction?
Monica [59]
It is an exothermic reaction
4 0
3 years ago
If the equilibrium constant of the reaction is 0.85, then which statement is true if the mass of A is 10.5 grams; the density of
snow_tiger [21]

Answer:

E. Q < K and reaction shifts right

Explanation:

Step 1: Write the balanced equation

A(s) + 3 B(l) ⇄ 2(aq) + D(aq)

Step 2: Calculate the reaction quotient (Q)

The reaction quotient, as the equilibrium constant (K), only includes aqueous and gaseous species.

Q = [C]² × [D]

Q = 0.64² × 0.38

Q = 0.15

Step 3: Compare Q with K and determine in which direction will shift the reaction

Since Q < K, the reaction will shift to the right to attain the equilibrium.

8 0
3 years ago
How many molecules are in 10.0 miles of C2H6O
shutvik [7]
6.02 x 10²⁴ molecules of C2H6O
3 0
3 years ago
Other questions:
  • Janice is given a mixture of alcohol and water. The teacher tells her that she can use temperature to separate these compounds.
    13·2 answers
  • A galvanic (voltaic) cell consists of an electrode composed of chromium in a 1.0 M chromium(III) ion solution and another electr
    8·1 answer
  • PLEASE HELP!!!!!!!!!
    10·1 answer
  • The Moon’s appearance changes during its ________ around Earth. These changes are called ____________________.
    10·1 answer
  • A sample of Br2(g) takes 12.0 min to effuse through a membrane. How long would it take the same number of moles of Ar(g) to effu
    8·1 answer
  • If 35.0 grams of coal (carbon) burns in 58.5 grams of oxygen gas, how many grams of carbon dioxide can be produced? Describe the
    7·1 answer
  • 2-Methyl-2-pentanol can be made starting from two different ketone electrophiles using two different Grignard reagents: one from
    5·1 answer
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • The speed of light in a vacuum is 2.998x10^8 m/s. What is its speed in km/h?
    15·1 answer
  • Calculate AHræn for the following reaction
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!