If Earth was like a hardboiled egg, which part of Earth would the egg white represent?

Biology

2 answers:

xz_007 [3.2K]3 years ago

8 0

The answer is A
no its really just A like the first answer
man its hard to explain stuff

soldi70 [24.7K]3 years ago

4 0

Answer:

Option (A)

Explanation:

A boiled egg can be used as a model in order to understand the interior of the earth. The hard outer shell can be considered as the crust. The white portion is considered as the mantle and the yellow portion (yolk) represents the core of the earth.

The mantle is the middle layer of the earth that extends up to a depth of about 2900 kilometre. This layer is important because the convection currents are formed here due to the heat energy supplied from the interior of the earth. This convection current is responsible for plate motion.

Thus, the correct answer is option (A).

You might be interested in

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0

3 years ago

I need help please thank you.

Fantom [35]

Hey!
8= B : adenine with thymine , guanine with cytosine.

9= False : its not single , *dual* helical structure.

10= Every humans' DNA is different but its as similar as our relatives' DNAs as far as i know so its False.

11 = The two backbones of the DNA molecule consists a deoxyribose sugar ^with 5 carbone^ and a phosphate so the correct answer is B

12= Procaryotes' Genomes are simpler- structured than eukaryotes' so procayotes DNA is 1/1000 of eukaryotes.I couldnt translate the options correctly (im not native sorry) but i think its B according to my knowledge of that XD

13= the amount of adenine, guanine, thymime and cytosine must be same so the correct option is %40as well.

Hope it helps!!!
#MissionExam001

7 0

3 years ago

Adrian is recovering from schizophrenia. She has been taking high doses of antipsychotic medications for a very long period of t

Tamiku [17]

Answer:

Tardive dyskinesia.

Explanation:

Schizophrenia may be defined as the condition in which the individual is unable to accept reality and interpret the reality in different ways. The symptoms are hallucination, disrupted speech and nehativity.

Tardive dyskenia is the medical condition in which the individual cannot control their hand and body movements. This condition might occur due to the medication that have been taken to treat the schizophrenia. The drugs inhibits the effects of dopamine that causes tardive dyskenia.

Thus, the correct answer is option (b).

8 0

3 years ago

Read 2 more answers

Blood flow causes vibrations in the heart chambers and valves and produces sounds that can be heard with a stethoscope. Evaluate

Nonamiya [84]

Answer:A. iron level of the blood

Explanation:

5 0

3 years ago

Read 2 more answers

What does the the pigs wearing green ribbons represent in animal farm?