1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
balu736 [363]
3 years ago
7

Which structure does not belong in a prokaryotic cell

Biology
1 answer:
katen-ka-za [31]3 years ago
6 0
I believe the nuclear membrane
You might be interested in
If the half-life of a radioactive atom is 3,500 years. How old is the substance if the parent-daughter ratio is 1:127?
balu736 [363]

Answer:

2.447 × 10⁴ years

Explanation:

Step 1: Given data

  • Half-life of the radioactive atom (t1/2): 3,500 years
  • Parent-daughter ratio ([A]/[A]₀): 1:127 (1/127)

Step 2: Calculate the rate constant

Radioactive decay follows first-order kinetics. We can calculate the rate constant (k) using the following equation.

k = ln2 / (t1/2) = ln2 / 3,500 y = 1.980 × 10⁻⁴ y⁻¹

Step 3: Calculate the time elapsed (t)

For first-order kinetics, we will use the following expression.

ln ([A]/[A]₀) = -k × t

t = ln ([A]/[A]₀)/ (-k)

t = ln (1/127) / (1.980 × 10⁻⁴ y⁻¹) = 2.447 × 10⁴ y

3 0
3 years ago
Why it is more difficult to do a squat for 1 minute than to stand for 1 minute?
Shkiper50 [21]

Answer:

because your body is using more energy while doing a squat, then while standing .

Explanation:

hope i helped :) !!!!

brainliest ?? please :) !!

5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Question 6<br> Which kingdoms have some organisms that can make their own food (autotrophic)?
Katena32 [7]

Answer:

Prokaryotae, Protoctista, Plantae

Explanation:

8 0
3 years ago
Read 2 more answers
What characteristic makes the HeLa cells some of the most celebrated and widely used cells by scientists today? *
omeli [17]

Answer:

It's an immortal cell line derived from cervical cancer cells taken from Henrietta Lacks used in scientific cancer research

5 0
3 years ago
Other questions:
  • Which of the following terms refers to how genetic traits are expressed?
    8·1 answer
  • The ______ promotes the development of businesses focusing on clean energy. environmental protection agency (epa) clean energy i
    13·1 answer
  • Based on what you were told about the reproduction of the snails, write a question that could be researched.
    13·2 answers
  • What is the main ingredient in magnets? *
    8·2 answers
  • Can someone let me know if this answer are correct. please ​
    8·1 answer
  • The DNA molecule is very similar among all living things. The pairings are always the same and
    6·2 answers
  • A nonsense mutation is defined as which of the following changes to the DNA
    15·2 answers
  • During photosynthesis,plants take in carbon dioxide,water,and energy from the sun and produce carbohydrates and oxygen.Which of
    12·1 answer
  • Ordinary table salt is sodium chloride. What is baking soda?
    11·2 answers
  • Which accessory eye structure is not correctly matched with one of its functions?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!