1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natima [27]
3 years ago
9

Why is inheritance in humans harder to study than in inheritance in Mendels peas plants?

Biology
1 answer:
Nimfa-mama [501]3 years ago
6 0
Because human inheritance is significantly more complicated and interconnected, while Mendels peas plants' inheritance pattern is fairly straightforward and is one of the basic form of inheritance study. HOpe that helped!
You might be interested in
sports such as soccer involve running, stopping, jumping, and kicking. discuss how friction helps players
olga_2 [115]
Soccer players use special shoes called cleats which dig into the ground cleats use friction to make the soccer player go faster
8 0
3 years ago
Read 2 more answers
Xylem transport food. True or false
4vir4ik [10]
False, Xylem transports water.
8 0
3 years ago
Read 2 more answers
What is the relationship between these three structures?
Svet_ta [14]
The answer is <span>C. DNA controls the production of protein in the cell.

DNA is made up of nucleotides. The sequences of nucleotides carry information for the protein synthesis. DNA is stored inside the nucleus, one of the organelles present in all eukaryotic cells.</span>
7 0
3 years ago
Read 2 more answers
Which is the correct order the organisms would appear during primary succession?
pogonyaev
C, bushes and shrubs, mosses, lichens, grasses and annual flowers, trees 
hope I helped 


7 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Help plz i need the answers
    8·1 answer
  • Pistol shrimps amd gobies depend on each other for their shelter and protection and they have a beneficial relationship with eac
    8·2 answers
  • Which of the following is the best example of a way human lifestyles affect environmental systems? -----------------------------
    9·2 answers
  • What is a mass extinction?​
    8·2 answers
  • PLEASE help me ahahaha
    11·2 answers
  • Which nitrogen base sequence is the partner of C-A-T-C-G-A?
    10·1 answer
  • I need help ); anyone please
    8·1 answer
  • Beginning from the center of the inside of the Earth, list the layers of the Earth
    5·1 answer
  • PLEASE HELP !!
    14·1 answer
  • Who discovered uses for peanuts and sweet potatoes?.
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!