Since there are no given choices, I would just compare and contrast DNA and RNA. These are the two types of nucleic acids in the human body. The structural unit of nucleic acids are composed of repeating units of monomers called nucleotides. Nucelotides are composed of three functional groups: sugars which are specifically pentoses (5-Carbon sugars), phosphate group and nitrogenous base.
Now, the RNA and DNA differ in the composition of these sugars and the bases. Based on the nitrogenous bases and sugar, the DNA has a deoxyribose as the sugar and its 4 bases are adenine, guanine, cytosine and thymine. For RNA, the sugar is ribose while its 4 bases are <span>adenine, guanine, cytosine, and uracil.
They also differ in their structure. </span>DNA is a double stranded β-helix with a long chain of nucleotides. RNA is composed of a shorter chain with a single strand α-helix structure.
Lastly, they differ in their functions. T<span>he DNA is responsible for storing the genetic information while the RNA is responsible for transporting the genetic information to the ribosomes which synthesize proteins.</span>
Answer:
After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is
Explanation:
1. AACGTACGATCGATGCACATGCATGGCTACGC
Complementary strand
TTGCATGCTAGCTACGTGTACGTACCGATGCG
Protein encode: NVRSMHMHGY
2. CCCGGGTATGCATGTACGTACGTCGTATATCG
Complementary strand
GGGCCCATACGTACATGCATGCAGCATATAGC
Protein encode: PGYACTYVVY
3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT
Complementary strand
GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA
Protein encode: RDRAIDECLV
4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG
Complementary strand
AATTTGCTCGACGATCGATAAAAATTTTGGGGC
Protein encode: LNELLAIFKTP
Two things required are water(H2O), carbon dioxide (CO2), and chlorophyll
Sperm cells inside the pollen grain travel down the pollen tube and into the ovary which contains the ovules. Fertilization occurs when one of the sperm cells fuses with the egg inside of an ovule
Researchers have identified specific gene variants in the receptors that detect sweetness: TAS1R2 and TAS1R3. There is also high variation in the detection of bitterness. However, the story is more complicated than sweet taste, as we have 25 receptors that detect different bitter molecules
