1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Volgvan
3 years ago
8

If a mother carries a recessive allele for a genetic disorder, such as cystic fibrosis, under what circumstances will her childr

en inherit the disorder? The children's father must also carry the recessive allele. The mother's father must also carry the recessive allele The paternal grandfather must also carry the recessive allele. The children must be female like the mother to inherit the disorder

Biology
2 answers:
aev [14]3 years ago
5 0
The children's father must also carry the recessive allele. Recessive alleles only determine characteristics when a child inherits a copy from each parent.
lutik1710 [3]3 years ago
3 0

Answer:

The correct answer would be "The children's father must also carry the recessive allele".

Cystic fibrosis is an autosomal recessive disorder. Thus, a person must homozygous recessive in order to produce a phenotype.

Let C and c be the allele of the gene responsible for the disease. C is the dominant allele which codes for normal physiology and c be the recessive allele which codes for the disease when present in homozygous condition.

The mother is the carrier of the diseases that means she is heterozygous (Cc) for the disease.

In order that her children would get the disease, the father must carry c allele. He can be Cc or cc.


You might be interested in
Marine science notes what is marine science
irga5000 [103]

Answer:

The study of oceans and their life.

Explanation:

The study of oceans, including seawater, the ocean floor, and marine plants and animals.

7 0
3 years ago
Read 2 more answers
Distinguish a virus from a prophage.​
vazorg [7]

\:  \:  \:  \huge \color{blue} \boxed{ \colorbox{black}{Answer}}

A prophage is a bacteriophage (often shortened to "phage") genome inserted and integrated into the circular bacterial DNA chromosome or exists as an extrachromosomal plasmid. This is a latent form of a phage, in which the viral genes are present in the bacterium without causing disruption of the bacterial cell.

▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬▬

6 0
2 years ago
A moving hang glider has ____ energy, which converts to _____ energy once the hang glider stops.
Sunny_sXe [5.5K]
A moving hang glider has kinetic energy, which converts to potential energy once the hang glider stops.
4 0
2 years ago
Read 2 more answers
Tropical rain forests have the greatest biodiversity of any type of land ecosystem. How does biodiversity contribute to the sust
Doss [256]

Answer:

The higher biodiversity in an ecosystem means that there is a greater variety of genes and species in that ecosystem.

Explanation:

3 0
3 years ago
Which state of matter is most likely represented in the diagram shown below?
insens350 [35]

The picture below represents; A. Gas

5 0
3 years ago
Read 2 more answers
Other questions:
  • A gardener is concerned that her greenhouse is getting too hot from too much light and seeks to shade her plants with colored tr
    15·1 answer
  • All cell membranes are primarily composed of _____________.
    14·2 answers
  • Which property causes atomic particles to attract or repel each other
    5·1 answer
  • Why does active transport take place in the small intestine during absorption of food molecules? I thought it was only diffusion
    11·1 answer
  • Emotional effects of steroid use seem to depend on the _______ of the steroid used.
    12·2 answers
  • 5' ATGCCCGGGTGTCGTAGTTGA3' Complete the complementary sequence for the template strand
    5·1 answer
  • How long does adaptation usually take? (Plant)
    8·1 answer
  • BIOLOGY PLS HELP AND BE HONEST!!
    10·2 answers
  • Describe how a supernova and neutron star are related?
    13·1 answer
  • Digestion of an unlabeled carbohydrate results in increased amounts of the monosaccharides glucose and galactose. Which is most
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!