1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Brilliant_brown [7]
3 years ago
7

What is a covalent bond?

Biology
2 answers:
hoa [83]3 years ago
5 0
A covalent bond, also called a molecular bond, is a chemical bond that involves the sharing of electron pairs between atoms. These electron pairs are known as shared pairs or bonding pairs, and the stable balance of attractive and repulsive forces between atoms, when they share electrons, is known as covalent bonding.
svetlana [45]3 years ago
5 0

Answer:

A chemical bond formed when electrons are shared between two atoms.

I hope this helps! Best of luck! :)

You might be interested in
Which sex chromosome determines the sex of a baby?<br>Explain your answer.​​
never [62]

Answer:

Girls have two X chromosomes  and boys have chromosomes (XY).

Explanation:

Girls have two X chromosomes (XX), and boys have one X and one Y chromosome (XY). Whether a baby will be a boy or a girl is determined at the time of conception.

4 0
3 years ago
A smartphone app converts spoken English into Spanish. This is similar to the process by which ________ are converted into _____
Over [174]

Answer:

The correct answer is - nitrogenous bases in mRNA, a sequence of amino acids.

Explanation:

The translation is one of the two-stage events in protein synthesis. Protein synthesis is the process in which protein or polypeptide chains are synthesized by the DNA.

The translation process is similar to a smartphone app converts spoken English into Spanish as it involves the translation of the sequence of nitrogenous bases in mRNA molecules to the polypeptide or sequence of the amino acids.

Thus, the correct answer is -nitrogenous bases in mRNA, a sequence of amino acids.

5 0
3 years ago
Considering the body’s organization from atoms to organ systems, in which level of organization are proteins like collagen? Desc
storchak [24]

Answer:

According to the levels of organization in the body, the level of organization in which proteins, like collagen, are found is the molecular level, allowing the structural support and the performance of other essential functions.

Explanation:

Proteins are biological macromolecules, polymers of units called amino acids. These molecules belong to the molecular level of organization in living organisms.

The level of organization where proteins are found allows them:

  • <em>Form an essential part of cells.</em>
  • <em>Contribute to the construction of tissues and organs.</em>
  • <em>Participate in metabolic reactions, as enzymes. </em>
  • <em>Defense of the organism, in the form of antibodies.</em>
  • <em>Regulation of vital functions, forming hormones.</em>

Other functions of proteins are to integrate the cell membranes and perform transport function, to form receptors and to be an energy reserve.

7 0
3 years ago
In which of the following ways are tRNA and mRNA different?
ra1l [238]
The correct option is C.
5 0
3 years ago
Read 2 more answers
How are nucleus and chloroplasts different?
Kamila [148]

Answer:

Chloroplasts are endosymbiotic descendants of photosynthetic cyanobacteria-like prokaryotes that were incorporated into cells more than a billion years ago.

Explanation:

Photosynthesis converts electrochemical energy from light into sugars and acts as the carbon source of the cell.

4 0
3 years ago
Read 2 more answers
Other questions:
  • Describe the type of attitude that would help of attitude that would help to make a good scientist?
    12·1 answer
  • Lipids are supplied in large quantities in the diet by: a. fats, oils, meats, and nuts. b. cereals, fruits, vegetables, and brea
    5·1 answer
  • I just bombed this test and i have 1 retake left. please help!!
    13·2 answers
  • What are the three major types of rocks?
    14·2 answers
  • using figure 9-1, which pairing matches the structures shown in the cell diagrams with the processes that take place within thos
    7·2 answers
  • How are viruses different from bacteria? A) Bacteria are heterotrophic while viruses are autotrophic. B) Bacteria are living org
    15·2 answers
  • Which are characteristic of type A blood?
    11·1 answer
  • During which phase of the cell cycle do the replicated chromosomes thicken and become visible
    9·2 answers
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Please complete he following questions below before Friday, March 19th at 11:59 PM EST.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!