1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anni [7]
4 years ago
10

Humans have greatly increased the level of _______ in the atmosphere

Biology
2 answers:
vivado [14]4 years ago
5 0
Pollution or Carbon Dioxide
Damm [24]4 years ago
3 0

Answer: Carbon dioxide.

Explanation:

There is a significant increase of carbon dioxide in the atmosphere due to the human impact.

There is a significant increase in the level of carbon dioxide when compared to previous decades.

This is due to increase in the number of vehicles on road, more industrial setup, more carbon emissions due to commercial equipment.

You might be interested in
Which of the following brain structures is involved in regulating hunger, thirst, temperature, and sexual behavior?(A) Hypothala
scoray [572]

Answer: Option A.

The hypothalamus is the brain structure responsiblre for regulating thirst, hunger, temperature and sexual behaviour.

Explanation:

Hypothalamus is a part of brain structures located at the floor of the third ventricle below the thalamus and its control the autonomic system.

It controls hunger, thirst, temperature, fatigue, sleep and sexual behaviour . Hypothalamus secretes the anti diuretic hormones which increases the level of water absorbed into the blood by the kidneys and corticotropin releasing hormone which regulate immune system.

4 0
4 years ago
A farmer in western Minnesota is retiring. He wants to stop farming his 3,000 acres and turn the land into a prairie. He begins
Snowcat [4.5K]
B    b is the right answer

8 0
3 years ago
How many bones are in the human body?
liraira [26]

Answer:

206 bones

Explanation:

4 0
3 years ago
Read 2 more answers
What is the approximate percentage of guanine in the DNA genome of E. coli?
Nadya [2.5K]

Answer:

25%

Explanation:

<em>The approximate proportion of G + C content in the genome of E. coli has been reported to be 50%. According to Chargaff's rule, the amount of guanine in any DNA must be approximately equal to the amount of cytosine. </em>Hence,

if G + C = 50 and G = C,

then

G = C = 25

Therefore, the approximate percentage of guanine in the genome of <em>E. coli </em>would be 25.

6 0
3 years ago
A client who is on monoclonal antibody medication reports rigors, headache, myalgia, and gastrointestinal disturbances. the medi
Mama L [17]
<span>Muromonab-cd3 can activate T cells to release cytokines within the body. This excess of cytokines is likely what is producing these symptoms in the client. The client should start taking some type of glucocorticoid, as well as acetaminophen and diphenhydramine to reduce global inflammation and counteract the effects of the Muromonab-cd3.</span>
5 0
3 years ago
Other questions:
  • Which of the following statements about antibodies is false?
    15·2 answers
  • If a child has two genes for blonde hair (one from each parent), his genotype is said to be
    6·2 answers
  • Things that affect the Functions of an enzyme
    7·1 answer
  • The __________ guards the entry of food into the stomach.
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • What way does the glucose go?
    15·2 answers
  • 13. How many plates are approximately floating on the mantle?
    10·2 answers
  • Evolution occurs when?
    5·2 answers
  • Please please help
    12·1 answer
  • PLEASE HELP I WILL MARK BRAINALISTTTT
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!