1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
deff fn [24]
4 years ago
8

6. How can we decrease the amount of atmospheric CO.?

Biology
1 answer:
kirza4 [7]4 years ago
7 0
We can decrease the amount of atmospheric CO2 by:

1. Reduce, Reuse, Recycle.
2. Use Less Heat and Air Conditioning.
3. Replace Your Light Bulbs.
4. Drive Less and Drive Smart.
5. Buy Energy-Efficient Products.
6. Use Less Hot Water.
7. Use the "Off" Switch.
8. Plant a Tree.
You might be interested in
I need help with this question
Zielflug [23.3K]
Colloid- C)
Emulsion- A)
Heterogeneous- D)
Homogeneous- B)

Hope this helps!!
8 0
3 years ago
Earth's biosphere is?
Alika [10]
A. Every biome that has living things.
5 0
3 years ago
Read 2 more answers
What does one cell become in mitosis?<br> and <br> what does one cell become in meiosis?
Romashka [77]

One cell produces two genetically identical daughter cells is both mitosis and meiosis.

5 0
3 years ago
Read 2 more answers
True or False Palm trees are gymnosperms.
NeTakaya
False. they are angiosperms
4 0
3 years ago
Read 2 more answers
Which of the following would most likely happen if DNA polymerase were not functioning properly during DNA replication? . a. Any
lapo4ka [179]
Out of the following, the one that would most likely happen if DNA polymerase were not functioning properly during DNA replication is the new strands of DNA would not be an exact copy of the original DNA. So the correct answer will be C. 
4 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Haploid/gametes/sex cell number in humans is ___________
    13·1 answer
  • Name two reasons why cells undergo mitosis
    6·1 answer
  • Nature has a way of of causing organisms that inherit advantageous traits to survive and reproduce more successfully than ones t
    7·1 answer
  • Which division of the plant kingdom is made up of plants that have flowers or fruit?
    7·2 answers
  • 3. What are 6 things the ocean provides for humans?
    12·1 answer
  • In the ocean near Antarctica, small crustaceans called krill eat algae and other phytoplankton. Krill are eaten by
    5·2 answers
  • What 2 processes drive the carbon cycle?
    14·2 answers
  • Athletes are often concerned with the question of how much protein they need
    8·1 answer
  • Which of the following is a type of lipid or composed of lipids?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!