Answer:
Corbin recently found out that he has cancer, and he now strictly follows a treatment, diet, and exercise program that the doctor thinks will be helpful in keeping the cancer from spreading. These behaviors best illustrate <u>problem-focused</u> coping.
Explanation:
Problem-focused coping seeks to tackle the stressor head-on allowing the individual greater perceived control over their problem resulting in :
- Managing and changing the stressor
- Use if problem seems alterable
- Confrontice coping
- Planful problem solving
As Cobbin is strictly following treatment, diet and exercise programs that the doctor thinks will be helpful in keeping the cancer from spreading, Cobbin is showing <u>problem-focused coping.</u>
Answer:
<h2>
A. mRNA ( messenger RNA),B. rRNA (ribosomal RNA) and C. tRNA (transfer RNA )</h2>
Explanation:
A. mRNA ( messenger RNA);
i)it is the most abundant form of RNA
,
ii) specifies the amino acid sequence for a protein
,
iii) contains exons.
B. rRNA (ribosomal RNA);
i) it is assembled in the nucleolus
,
ii) is a component of ribosomes
.
C. tRNA (transfer RNA );
i) contains anticodon,
ii) has amino acids covalently attached
.
Answer:
Your kidneys also remove acid that is produced by the cells of your body and maintain a healthy balance of water, salts, and minerals—such as sodium, calcium, phosphorus, and potassium—in your blood. Without this balance, nerves, muscles, and other tissues in your body may not work normally.
4H— Arma biotecnologíca altamente efectiva para la protección del medio ambiente 1V— Ámbito donde la biotecnología Y las técnicas de bioingeniería Han encontrado un eco de mayor resonancia. 2V—-
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
