1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
algol13
3 years ago
7

Alleles that are linked on the same chromosome will assort independently during meiosis.

Biology
1 answer:
KIM [24]3 years ago
7 0
The answer is A or true
You might be interested in
What are sedimentary rocks that form from evaporating sea water called?
Leona [35]

A. chemical is your answer

3 0
3 years ago
The simplest level of organization and basic unit of life is the ___________.
Lesechka [4]

The answer is A, the cell

6 0
3 years ago
Read 2 more answers
How many cells are made in a month?​
Firlakuza [10]

Explanation:

A new calculation reveals just how intensive that process is. According to biologists Ron Sender and Ron Milo of the Weizmann Institute of Science in Israel, your body replaces around 330 billion cells per day. At that rate, your body is making over 3.8 million new cells every second.

5 0
2 years ago
Read 2 more answers
When scientists examined the whales' stomachs', they found proof that the whales died from a poison produced by algae, but the w
pishuonlain [190]

Explanation:

Its stomach was filled eith 30 plastic bags, and many smaller pieces of plastic. ... The whale was emaciated, and scientists believe that the plastic had gathered in such an amount in its stomach that it had created a plug, stopping the digestive process.

The cause of death appears to be starvation, though that's under investigation. Many of the stranded whales in 2019 have been malnourished, said David Weller, a research wildlife biologist with NOAA's Southwest Fisheries Science Center in La Jolla, California.

6 0
3 years ago
Read 2 more answers
4
bearhunter [10]

An increase in the number of snakes.

Please mark Brainliest

6 0
3 years ago
Other questions:
  • What is the normal range of blood pressure
    15·2 answers
  • The qualities and characteristics that shape a person's unique character and identity refer to
    13·2 answers
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Which statement about the composition of ocean water is true?
    9·1 answer
  • White fruit color in summer squash is governed by a dominant gene (W) and colored fruit by its recessive allele (w). Yellow frui
    11·1 answer
  • Which of the following statements about viruses is true?
    7·1 answer
  • True or false please be experienced and know what you are doing. If you are not good at life science please skip this question.
    7·1 answer
  • Which property of water makes it most suitable for transport in eukaryotic organisms ?
    15·1 answer
  • When a large rock falls down a slope and breaks into small pieces, this is called
    9·1 answer
  • Why does your upper body want to keep moving when you stop running suddenly?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!