Answer:
A. in order to release the energy found in food.
Explanation:
Every cell in your body needs oxygen to function. You get the oxygen your cells need from the air you breathe. The air you breathe is made up of 20 percent oxygen. The rest of the air is mostly nitrogen (79%). Your body cells use the oxygen you breathe to get energy from the food you eat. This process is called cellular respiration. During cellular respiration the cell uses oxygen to break down sugar. Breaking down sugar produces the energy your body needs. This is very similar to wood burning in a fire. As the wood burns, it combines with oxygen and releases heat energy and carbon dioxide. When the cell uses oxygen to break down sugar, oxygen is used, carbon dioxide is produced, and energy is released. But instead of heat energy, much of the energy produced in cellular respiration is stored chemically for the cell to use later. Carbon dioxide is the waste product of cellular respiration that you breathe out each time you breathe. Blood picks up oxygen and releases carbon dioxide in the lungs. The opposite takes place in the cells where the blood releases oxygen and picks up carbon dioxide.
Dicot mark me brainliest please thank you
Answer:
Let's organize this with the four biomolechules:
-NUCLEIC ACID (Nucleotides, Polynucleotides, Phosphodiester linkages)
-LIPIDS (Fatty acids, Triacylglycerols, Ester linkages)
-PROTEINS (Polypeptides, Pepptide bonds, Aminoacids)
-CARBOHYDRATES (Monosaccharides, Polysaccharides, Glycosidic linkages)
Explanation:
Answer for this question will be
3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand will be 5'UACGGGCCCACAGCAUAACU 3'
