1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marta_Voda [28]
3 years ago
11

Anaerobic respiration produces a maximum of ______ atp per glucose. 2 4 10 36 38

Biology
1 answer:
vfiekz [6]3 years ago
4 0
<span>Anaerobic respiration produces a maximum of 2 atp per glucose. </span>
You might be interested in
Which membrane would show a more rapid recovery of fluorescence in a frap study?
ziro4ka [17]

Answer: a membrane containing a larger proportion of unsaturated fatty acids

Explanation:

4 0
3 years ago
The hydrosphere, lithosphere, biosphere, and atmosphere are all examples of __________.
vlada-n [284]

Answer:

The answer is A, open systems!!

Explanation:

all systems on earth are open, except for the earth itself.

6 0
3 years ago
Which describes active transport, but not passive transport?
Gre4nikov [31]

Answer:

c

Explanation:

7 0
3 years ago
Menstruation does not occur if the
Dmitrij [34]
Menstruation does not occur if the D) egg is fertilized.
If you are pregnant, you don't menstruate.
8 0
3 years ago
RNA plays important roles in many cellular processes, particularly those associated with protein synthesis: transcription, RNA p
alukav5142 [94]

Answer:

Messenger RNA (mRNA), molecule in cells that carries codes from the DNA in the nucleus to the sites of protein synthesis in the cytoplasm (the ribosomes).

Explanation:

8 0
4 years ago
Other questions:
  • What is the difference between casual observers and scientific observers?
    8·2 answers
  • How do you tell if the ground sill start to liquify during an earthquake? How do you find out? Test the soil?
    10·1 answer
  • A scientist wanted to formulate a pill to attack a specific type of bacteria that infects the throat. Which biological component
    6·2 answers
  • Which organs of the digestive tract lack digestive enzymes?
    15·1 answer
  • Choose the correct order of classifying organisms in the Linnaean system. kingdom→phylum→ class→ order→ genus→ family → species
    5·1 answer
  • What is the DNA compliment to the given strand TACGTATGCCGTATGGGCATT
    13·1 answer
  • Where is the flow of energy from the earth interior observable and measurable without sensitive scientific equipment
    10·1 answer
  • Chemical formulas can have three components. Help me with the worksheet plz.
    12·1 answer
  • HURRY PLSSSSS Scientists have a theory about the relationship between climate and biodiversity. Which best describes this theory
    5·2 answers
  • Two linebackers tackle a quarterback. One hit him with a force of 105 N and the other hit him with a force of 150 N. They are bo
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!