1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Umnica [9.8K]
3 years ago
11

If a sponge were torn apart by a predator, predict what would happen

Biology
1 answer:
melomori [17]3 years ago
8 0
Cells could live and possibly reform a new sponge
You might be interested in
Which descriptions of evolution are accurate? Check all that apply. It occurs within an individual’s lifetime. It occurs over ma
erik [133]
<h3><u>Answer;</u></h3>

It occurs over many generations.

It happens at the genetic level.

<h3><u>Explanation</u>;</h3>
  • <em><u>Evolution is the process that involves change in the inherited traits of a population over generations. </u></em>
  • <em><u>The traits involved are the expressions of genes that are copied and passed from the parents to the offspring during reproduction process. Mutations in these genes results to new traits and thus heritable differences among organisms.</u></em>
  • <em><u>Therefore, evolution will only occur when there is change in gene frequency within a population over a given period of time. Genetic differences that are heritable are passed to the next generation.</u></em>

8 0
3 years ago
Read 2 more answers
Reactive oxygen species (ROS) are unstable, or reactive, compounds that result from the partial reduction of oxygen. ROS can cau
Genrish500 [490]

Answer: .OH, O2-, H2O2

Explanation:

Reactive oxygen species (ROS) are chemically reactive and unstable species containing oxygen. ROS are formed when oxygen is partially reduced, thus they are all radicals with very high reactivity, attacking membrane proteins such as ion channels etc

Examples include peroxides (H2O2), superoxide (O2-), hydroxyl radical (.OH)

6 0
3 years ago
Read 2 more answers
Ameoba moves by<br><br> A. Pseudopods<br><br> B. Cilia <br><br> C. Flagella<br><br> D. By water
hjlf

Answer:

A. Pseudopods

Explanation:

Amoebae use pseudopodia to move

6 0
4 years ago
Read 2 more answers
Juan and his science class are constructing models of sugar crystals. He wants his model to show how the sugar molecules move in
inna [77]

Answer:

The correct answer is option B. "Fill a clear cube with them".

Explanation:

Sugar crystals, colloquially known as "rock candy", are conglomerates of sugar molecules that are formed when sugar-saturated water are cooled. Sugar crystals are arranged in a three dimensional repeating pattern, forming a cube like structure. Therefore, Juan could fill a clear cube with its plastic foam balls to represent sugar crystals. I attached an image of sugar crystals dissolving in water as reference.

4 0
3 years ago
Where should the breastplate on the restraint straps rest in the infant?
fomenos
For the answer to the question above, the best part to place the breastplate to restraint an infant especially on cars in the armpit level. If you place it below. They might have a difficulty in breathing. Higher than armi. they might choke their neck. So the best place is in the Armpit level.
4 0
3 years ago
Read 2 more answers
Other questions:
  • In which step of the diagram is the provirus formed? step A step B step E step F
    6·2 answers
  • Trees that have thick waxy needles to prevent water loss and protect from cold would most likely be found in which biome?
    8·2 answers
  • Two of the following statements are false. Circle the letter and fix each statement to make it true.
    9·1 answer
  • Which is the correct order of materials in terms of reflectivity, from least to greatest?
    5·2 answers
  • In the fruit fly Drosophila melanogaster, the recessive allele (p), when homozygous, determines pink eyes. Pp or PP results in w
    6·1 answer
  • Bart believes that mice exposed to radiowaves will become extra strong (maybe he's been reading too much Radioactive Man). He de
    8·1 answer
  • Which country is represented by the number 1?
    9·2 answers
  • The shrimp in the photograph are small crustaceans, related to lobsters and crabs. Two shrimp. Photo by Russ Hopcroft, courtesy
    15·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • What was Frank’s body temperature before thrax entered?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!