1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nydimaria [60]
3 years ago
6

The stomach select one:

Biology
1 answer:
denpristay [2]3 years ago
4 0
I would say it's b.
stomach doesn't secrete lipase, only pancreas does.
stomach also doesn't manufactures bile, the liver does.
stomach contents are highly acidic , it's around pH 2.0 , which is completely opposite to alkaline
You might be interested in
2. The volume of water in the pot decreases during this investigation. Water droplets form on
goldfiish [28.3K]

We can confirm that throughout this experiment, the water vaporized, then condensed into a liquid once again.

<h3>Why did the water vaporize and then condense?</h3>

As the water was heated by the electric heater, its internal temperature increased. Once this temperature reached the boiling point of water, the water vaporized or evaporated into a gas. This gas then reached the mirror, where it collected and cooled down, condensing back into a liquid in the form of water droplets.

Therefore, we can confirm that throughout this experiment, the water vaporized, then condensed into a liquid once again.

To learn more about water condensation visit:

brainly.com/question/15563071?referrer=searchResults

5 0
2 years ago
NADPH and ATP are produced during what part of photosynthesis?
vlada-n [284]

Answer:light dependent

Explanation:

8 0
4 years ago
Patient has a suspicious lesion of the right axilla. the area was infiltrated with local anesthetic and prepped and draped in a
den301095 [7]
<span>11400, 702.19

- CPT 11400  coded as </span><span>Excision, benign lesion, except skin tag (Only of listed elsewhere), trunk, arms or legs; lesion diameter 0.5 cm or less.

this code should only be used when the excision is in full thickness lesion removal that includes the margins, and also including of simple closures. 

- </span><span>ICD-9-CM Diagnosis Code 702.19 - other Seborrheic Keratosis.</span>
7 0
3 years ago
The tRNA for GUCAUCGAUCGAUCGGAUGCC
Lapatulllka [165]

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3 0
3 years ago
Discuss how algae help support other life on earth?
poizon [28]

Answer:

In the distant past, algae helped turn the earth's then inhospitable atmosphere into one that could support modern life through photosynthesis, which plants use to turn carbon dioxide and sunlight into sugars and oxygen. Some of the algae sank to sea or lake beds and slowly became oil.

5 0
3 years ago
Other questions:
  • Define the first two laws of thermodynamics, and define them using examples for each law.
    15·1 answer
  • What type of wave interference would affect the amplitude of a wave?
    6·1 answer
  • How do the leaves help trees survive in their respective biomes? A. The temperate leaves are broad and flat to maximize sunlight
    6·1 answer
  • How do the base pairs match up?
    9·1 answer
  • While on an intersession course in tropical ecology, Kris pulls a large, snakelike organism from a burrow (the class was granted
    5·1 answer
  • Scientists know that organisms that are more closely related will have DNA sequences more similar to each other than organisms t
    7·2 answers
  • Which cell organelles produce energy in eukaryotic cells? select one of the options below as your answer:
    8·1 answer
  • 2. In order to grow, animals with an exoskeleton must
    7·1 answer
  • 5 tips to improve your critical thinking - Samantha Agoos
    7·1 answer
  • What element DOES NOT make up amino acids
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!