Answer:
The Earth can be divided into 5 main layers according to their physical properties: the lithosphere (most superficial layer of the Earth: rigid and cold), the asthenosphere (Second most superficial layer of the Earth: soft and ductile), the mesosphere or lower mantle ( Middle layer of the Earth: rigid and hot, able to flow gradually), the outer core (Second innermost layer of the Earth: liquid) and the inner core (innermost layer of the Earth: solid). The flow of heat inside the Earth will depend on the temperature and the characteristics of the material. The crust behaves like a solid and has relatively low temperatures. The mantle behaves like a fluid and since convection is much more efficient in this case, that is the main means of transport, even though the relatively high temperatures make it possible for energy to also be transported by means of radiation.
Explanation:
As you descend into the Earth's interior, the temperature, pressure, and density of the rocks gradually increase. The Earth can be divided into five main regions based on its physical properties (temperature and pressure) and according to its mechanical resistance: lithosphere the chemical composition of this layer is notably different, it also acts as a unit that shows a rigid behavior (not can be bent), mainly because it is cold and consequently resistant, asthenosphere located in the upper mantle (at a depth of about 660 km), there is a comparatively plastic soft layer, mesosphere (lower mantle) more rigid layer and it is because as the pressure increases, it counteracts the effects of the higher temperature and the resistance of the rocks increases gradually with depth. Despite their resistance, the rocks of the mesosphere are still very hot and are able to flow in a very gradual way, the outer core is a 2270 km thick liquid layer. The convective currents of iron in this area are those that generate the Earth's magnetic field and the inner core of the material is more resistant than the outer core (due to the enormous pressure to which it is subjected) and behaves like a solid. When penetrating the crust of the Earth a change in temperature is observed, in general it increases; this variation in temperature with depth is called a geothermal gradient. The heat flux on the Earth's surface is calculated as the product of the geothermal gradient and the thermal conductivity of the rocks, these two parameters being directly determined. The Earth is basically made up of three concentric layers: the innermost core has a composition of cast iron at a temperature of over 4,000 ºC; the mantle that is the intermediate layer formed by iron and magnesium silicates and its temperature varies from 4,000 ºC in its contact with the core to 800-1000 ºC of its outer surface that contacts the crust that is the most superficial layer and visible by man. This crust has a variable thickness of 5 to 35 km and is made up of aluminum and magnesium silicates, its temperature varying between 800-1000 ºC of contact with the mantle and 15-20 ºC of the surface that we know.
Umm.. Planting trees gives us more trees...we need trees because they provide oxygen,food(some trees), resources(such as paper), homes for animal(where eles will the squirrel live).
Answer:
washing clothes and cooking
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
