1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zepelin [54]
3 years ago
8

Which statement best defines a community?

Biology
1 answer:
lesya692 [45]3 years ago
3 0
I believe all populations of organisms in an area
You might be interested in
Describe the Cell Cycle [Interphase, G1 phase, S phase, G2 phase]<br> describe them all please :)
Svet_ta [14]

<em>G1, S and G2 phases are all cumulatively referred to as interphase involving the growth of a cell and the replication of its DNA. Initially in G1 phase, the cell grows physically and increases the volume of both protein and organelles. In S phase, the cell copies its DNA to produce two sister chromatids and replicates its nucleosomes. Finally, G2 phase involves further cell growth and organisation of cellular contents. The S phase of a cell cycle occurs during interphase, before mitosis or meiosis, and is responsible for the synthesis or replication of DNA. In this way, the genetic material of a cell is doubled before it enters mitosis or meiosis, allowing there to be enough DNA to be split into daughter cells. The S phase only begins when the cell has passed the G1 checkpoint and has grown enough to contain double the DNA. S phase is halted by a protein called p16 until this happens.</em>

8 0
3 years ago
Read 2 more answers
What phenotype would an offspring have if one of the parents were homozygous dominant for a trait
Tema [17]
Dominant phenotype but it can not be determined if it would be homo/heterozygous without information of the other parent
7 0
3 years ago
A (n) ___ is made up of two or more elements bonded together.
Bas_tet [7]

Answer:

the answer would be compound

6 0
3 years ago
After 8 weeks on the different diets, the scientists collected the following data on the two groups of mice:
svetoff [14.1K]
You didn't really provide the required table. But as a general hint, you should look at the differences between the two groups and then you can see what were the differences in amount of weight gained, amount of body fat, as well as the composition of the microbial community. 
3 0
3 years ago
differentiate between Acute and chronic diseases ...(minimum 5 points each)......pls help fast ....i have my exam tomorrow
Viefleur [7K]
Acute diseases are sudden, severe, and short term only. They quickly appear and worsen without warning and they disappear. Examples of this are flu or colds.  

Chronic diseases, on the other hand, are long-developing diseases. The symptoms have been present for long time and it worsens as time progresses. Examples of this are Osteoporosis and heart disease.
3 0
3 years ago
Other questions:
  • Which joins amino acid together?
    7·2 answers
  • In your own words, describe the structures in and the functions of the nervous system. include the major organs and how they wor
    6·1 answer
  • 3. Psychologists like to experiment on other organisms in their immediate environment, so Jenny
    6·1 answer
  • Describe environment and its causes
    8·1 answer
  • Which statement about the cell membrane is true?
    7·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Biochemistry:cytochrome::__
    6·1 answer
  • Explain the factors that affect a population's density?<br> Please explain thoroughly.
    6·1 answer
  • Why mesophyll cell is considered as parenchyma cell​
    9·1 answer
  • What happens if an organelle stops working
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!