2 years ago

Why aren't lipids considered polymers?

1 answer:

OverLord2011 [107]2 years ago

6 0

A polymer is made up of monomers. A monomer is a unit that occurs in repetitive chains. Lipids do not occur in repetitive chains, so they are not classified as monomers. Since they're not monomers, they can't make up polymers, either.

You might be interested in

1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC

Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0

2 years ago

How much would a 125 pound person weigh on pluto

Reika [66]

Answer:

77.5lbs

Explanation:

Weight × Pluto's surface gravity

125 x 0.62 = 77.5

3 0

2 years ago

Read 2 more answers

Identify a method scientists use to share information with one another

omeli [17]

A journal could be used as a recording device to share and show proof of scientific data.

7 0

2 years ago

What do you call an orange that smells like bananas

Luden [163]

I have I pineapple I have a pen...I forgot the rest

8 0

2 years ago

Is carbon dioxide an atom, element, molecule, or a compound?

LenKa [72]

Carbon dioxide is a compound.

3 0

3 years ago