1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alex73 [517]
4 years ago
8

Phase in which the cytoplasm splits

Biology
2 answers:
Sati [7]4 years ago
8 0
Cell division in eukaryotic cells includes mitosis, in which the nucleus divides, and cytokinesis, in which the cytoplasm<span> divides and daughter cells form. Mitosis occurs in four </span>phases<span>, called prophase, metaphase, anaphase, and telophase.hope this helps</span>
Karolina [17]4 years ago
6 0
<span>Cytokinesis is when the two cells split and create two daughter cells.</span>
You might be interested in
Why do some animals migrate or hibernate?
Ivenika [448]
From what I've learned so far about hibernation and migration...
Some animals migrate to head towards warmer weather and plentiful food.
Some animals hibernate to conserve energy so they can survive the harsh winters with little to no food at all.
I hope this helped you answer your question.
8 0
3 years ago
Question 5 (1 point) Which letter represents the trough of the wave? B
mezya [45]

Answer:

D

because trough is the lowest or the minimum point and here D represents it.

:))

3 0
3 years ago
Which of the following lacks a nucleus?
Andreas93 [3]

C) A virus since it isn't actually a living being nor is it a cell, which would have a nucleus.

7 0
3 years ago
Read 2 more answers
The presence of which of the following organelles or structures would most likely indicate that a cell is eukaryotic and NOT pro
Morgarella [4.7K]

Answer:

C. Nucleus

Explanation:

3 0
3 years ago
Within a eukaryotic cell, aerobic cellular respiration occurs within the _____.
alexandr1967 [171]

Within a eukaryotic cell, aerobic cellular respiration occurs within the _____.

Answer: Mitochondria
6 0
4 years ago
Read 2 more answers
Other questions:
  • What is the difference between density and density independent limiting factors
    14·1 answer
  • What is a behavior in mating in which one male breeds with a female for a certain period of time and then finds a different mate
    8·1 answer
  • Explain why spent nuclear fuel rods have to be treated as hazardous waste.
    14·2 answers
  • Which is not correctly paired concerning parasympathetic outflow? which is not correctly paired concerning parasympathetic outfl
    8·1 answer
  • The DNA in a cell’s nucleus encodes proteins that are eventually targeted to every membrane and compartment in the cell, as well
    14·1 answer
  • Explain the conditions for cloud formation
    13·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • Hi!! Help with these biology questions would be greatly appreciated! Thank you!
    13·1 answer
  • How would a saltwater fish respond if it is put in an aquarium of fresh water? A) Salt would move into the cells of the fish B)
    12·2 answers
  • Why do different cells have different functions?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!