1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
gizmo_the_mogwai [7]
3 years ago
5

The communication system in your body by which hormones influence thoughts, behaviors, and actions is the ________ system.

Biology
1 answer:
Svetach [21]3 years ago
6 0
Answer:  "endocrine" .
____________________________________________________________
     "<span>The communication system in your body by which hormones influence thoughts, behaviors, and actions is the <u>  endocrine  </u><u /> system." 
____________________________________________________________</span>
You might be interested in
A bird species known as the cattle egret is often found near farms in wet areas. The bird waits, sometimes even perched on a cow
sasho [114]
It’s not herbivorous because no, and it’s not detritus because again no, and not parasitic so your only answer left is mutualistic which it is
7 0
3 years ago
Read 2 more answers
Question 21 <br><br> need help asap <br> - 20 points included <br> it’s a quiz !
White raven [17]

Answer:

2nd answer is correct

BTW, its 5 points only..

However..

Hope it helps!!!

7 0
3 years ago
Read 2 more answers
Which kingdom includes only multi cellular heterotrophs whose cells lack a cell wall
masya89 [10]

The answer is Animalia.

I hope this helps!

Cheers, July.

6 0
3 years ago
Disadvantages of using inorganic manure​
Pie

Answer:

Inorganic fertilizers are not entirely composed of the nutrients needed by the plants. It also contains salts and other compounds. These are not absorbed by the plants so they are left behind in the soil and build up over time.

4 0
3 years ago
Read 2 more answers
What is the answer to these in emt 100% smart people answer it pls
Vsevolod [243]

Answer: T T F OR ITS T F F

LOOK AT MY RESONS TO MAKE SURE

Explanation: 1

Normal vital sign ranges for the average healthy adult while resting are: Blood pressure: 90/60 mm Hg to 120/80 mm Hg. Breathing: 12 to 18 breaths per minute. Pulse: 60 to 100 beats per minute

2

Vital signs reflect essential body functions, including your heartbeat, breathing ... Normal vital sign ranges for the average healthy adult while resting are: ... minute; Temperature: 97.8°F to 99.1°F (36.5°C to 37.3°C); average 98.6°F (37°C) .

Vital signs are a person's temperature, pulse, respiration, and blood pressure ... through homeostatic mechanisms and falling within certain normal ranges. ... but if the resident is classified as Medicare A (meaning they have been discharged from ... and in some self-care and psychiatric units, assessments are made

3

heart rate (newborn to 1 month): 85 to 190 when awake.

heart rate (1 month to 1 year): 90 to 180 when awake.

respiratory rate: 30 to 60 times per minute.

temperature: 98.6 degrees Fahrenheit.

Normal vital sign ranges for the average healthy adult while resting are: Blood pressure: 90/60 mm Hg to 120/80 mm Hg. Breathing: 12 to 18 breaths per minute. Pulse: 60 to 100 beats per minute.

8 0
3 years ago
Other questions:
  • Explain how living things, such as people and trees, are different from nonliving things, such as rocks and the tent.
    7·2 answers
  • An equation that shows how an objects acceleration relates to its mass
    12·2 answers
  • Which is the function of the DNA helicase enzyme in the DNA replication process?
    15·1 answer
  • Fruits ripen due to an enzyme converting starch into sugar. Keeping fruits
    14·1 answer
  • Nucleotides are the building blocks of dna and rna. One nucleotide is also used in the high-energy molecule (pictured below) ___
    14·1 answer
  • 5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
    10·1 answer
  • What do all members of the swine species always have in common ?
    9·2 answers
  • People who have 5 fingers on each hand are
    6·2 answers
  • Why do researchers think that seals use visual cues to<br> navigate?
    9·1 answer
  • Which do solar flares and coronal mass ejections have in common? Select the two correct responses.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!