1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Neporo4naja [7]
3 years ago
13

Identify the cavity that develops entirely from the mesoderm.

Biology
2 answers:
Allisa [31]3 years ago
4 0

I believe it would be mesentery

gogolik [260]3 years ago
3 0

Answer:

Coelom.

Explanation:

The coelom can be defined as a main body cavity, which is developed entirely fro the mesoderm layer. It is present in nearly all animals that contains and surrounds the organs of digestive tract.

During embryonic development, coelom can develop from mesoderm by two ways. In protostomes, coelom is formed by splitting of mesoderm cells, while in deuterostomes, coelom is formed due to combining of mesoderm cells.

Thus, the correct answer is 'coelom.'

You might be interested in
Pepsinogen is produced by __________ and is activated by __________
Ket [755]

Answer:

Pepsinogen is produced by chief cells and is activated by hydrochloric acid secreted by parietal cells.

Explanation:

Pepsinogen is a proenzyme produced in the chief cells (that are located in the stomach lining) that, when gets activated, is transformed into pepsin - a peptidase with the function to degrade proteins into amino acids.

The reason why pepsinogen is released inactive is that it would break down all of the cell's proteins because of its proteolytic nature. For this reason, it is released as a proenzyme and gets activated when reaches the acidic environment provided by the hydrochloric acid secreted by the parietal cells, also in the stomach lining.

7 0
3 years ago
Read 2 more answers
Raccoons and lesser pandas have many corresponding sequences of nucleotides.
Oksanka [162]

Analyzing the proteins of the Racoons and lesser pandas, there will be huge similarities with minor modifications.

These species will be very closely related.

<h3><u>Explanation:</u></h3>

The evolutionary background of the species are mainly studied based on the similarities of the nucleotide sequences and proteins. While studying the Lesser pandas and Racoons, there was a huge similarities in then based on their structures, and on their protein composition. The nucleotide sequences also showed huge similarities which also points that they have developed from same ancestor. This is why they are very closely related with each other by means of evolution.

5 0
3 years ago
A pea plant has one recessive allele for white flowers and one dominant allele for purple flowers. What flower color will the pe
baherus [9]

Answer:

the phenotype is PURPLE

Explanation:

3 0
2 years ago
Which region of Texas would be be best for growing crops
lora16 [44]
Big ole Texas yehaw
5 0
2 years ago
Abiotic factors in the environment are all _________. A. Easily measured B. Living C. The same as the dead things D. Non living
Ede4ka [16]

Answer:

the answer is d. non living

8 0
3 years ago
Other questions:
  • Fill in the blanks below with the correct word to complete the sentence.
    8·2 answers
  • What are some examples of positive symptoms of schizophrenia?
    7·1 answer
  • Why is the alarm calling of the vervet monkey an example of advanced communication?
    11·1 answer
  • How did the atomic bomb affect Hiroshima and the global community after the release of Little Boy?
    6·1 answer
  • What evidence supports the Big Bang theory of the origin of the universe
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • A farmer cut a branch from his favorite Richard fruit tree planted in the soil and eager to be a nutrient the farmers method of
    13·1 answer
  • According to the cell theory, all cells come from __________ cells.<br> A. existing<br> B.fertile
    7·2 answers
  • Please someone help TIMED EXAM
    14·2 answers
  • The Electromagnetic Spectrum ONLY has which shape of wave?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!