1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DaniilM [7]
3 years ago
12

You are a sun worshipper, constantly sunbathing without sun screen or other protective devices. in addition you are a smoker. th

ese together have significantly increased your chances of getting what disease?
Biology
1 answer:
aliya0001 [1]3 years ago
7 0
Increases your chance of getting cancer. whether it's skin cancer from the sun's radiation or lung cancer from inhaled compounds in cigarettes.
You might be interested in
I’LL GIVE A BRAINLIEST IF YOU ANSWER QUICKLY!!!
Serhud [2]

Answer:

Explanation:

Aquifers are groundwater reservoirs often tapped by wells. Water:  Water is pretty darn important for living things.

4 0
2 years ago
What do you mean by formatting text ?​
Liula [17]

What they mean by formatting text is ,to organise text in such a way that it becomes more attractive and easy to read

7 0
3 years ago
Which statement best describes members of the same species?
Ahat [919]

Answer: D.

Explanation: Members of the same species do not have the same number of cells. Think differences in height or weight. They do not have identical traits. Think siblings. They cannot create different species. Two wolves cannot make a coyote.

7 0
3 years ago
Click each test tube to test for the
liubo4ka [24]

Answer: does not contain protein

Because it is not pink and purple

Explanation:

Edge 2020

5 0
2 years ago
The bacteria chromosome is
BartSMP [9]
One long, single molecule of double stranded, helical, supercoiled DNA. In most bacteria, the two ends of the double-stranded DNA covalently bond together to form both a physical and genetic circle
7 0
2 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Plate tectonics may affect organic evolution because movement of plates may cause a change in ____.
    9·2 answers
  • A client diagnosed with heart failure presents with a temperature of 99.1° f, pulse 100 beats/minute, respirations 42 breaths/mi
    11·2 answers
  • Which best describes the purpose of connective tissue?
    9·1 answer
  • If a trait made an organism less likely to survive and reproduce what would happen to the allele for that trait?
    6·1 answer
  • Most of the carbon on Earth is stored in the form of
    8·2 answers
  • What is the uses of nuclear power?
    9·1 answer
  • Give one example of how urbanization affects ecosystems
    10·1 answer
  • choose the best option: Annual rings are the number of : (a) internodes in a stem (b) rings of vascular bundles in a monocot ste
    8·1 answer
  • How are elements related to the Earth's crust?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!