1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Liula [17]
3 years ago
8

What is biological evolution

Biology
2 answers:
Lina20 [59]3 years ago
6 0
Biological Evolution- is the refers to the cumulative changes that occurs ina population over a time.
Nana76 [90]3 years ago
5 0

Biological evolution is the genetic changes that occur in a population over successive generations. It is a process whereby changes occur on the genetic level of a population and it is being transferred from one generation to another. Biological evolution takes place as a result of natural selection and its result may be minimal (unnoticeable) or significant (noticeable). Biological evolution includes microevolution (minor genetic changes within a specie or population) and macroevolution (large evolutionary changes above the species level).

You might be interested in
Which of the following is true regarding the structure of enzymes?
Vesnalui [34]
Enzyme function is influenced by physical and chemical environment factors such as pH and temperature.
-Enzymes may require a nonprotein cofactor or ion for catalysis to take place.
-Enzymes increase the rate of chemical reaction by lowering activation energy barriers.
7 0
3 years ago
Hallux rigidus is a condition affecting what part of the body?
TEA [102]
The skin. Hallucinating rigidus is a somewhat rare condition where the shin hardens over time. Remember The story of killer croc? He had hallucinations rigidus, and this the name implies. It gives the body a scale like look and texture
6 0
3 years ago
one parent is homozygous cleft chin and the other is heterozygous. MAKE A PUNNET SQUARE to show the propability in their offspri
Mars2501 [29]

Answer:

50% AA and 50% Aa

Explanation:

Punnet square is a tool used to examine the offspring's genotype result of a breeding experiment. We will need to put the genotype of a parent in the row, and other parents at the column. The parent is homozygous(AA) and heterozygous(Aa), the square will be:

                       AA

                 A            A

        A     AA          AA

Aa    a      Aa           Aa

The result will be 50% AA and 50% Aa

3 0
3 years ago
What is the common language for scientific naming
Mekhanik [1.2K]
The common language that's commonly used for branding scientific names for animals and other types of plants is the Latin language. If you research the different terms used for scientific names, they have a meaning that goes in relationship to the animal or plant in question.
5 0
3 years ago
Charles Darwin developed his theories of evolution based on wildlife observations on which famous islands of Ecuador?
AleksandrR [38]

Answer;

The Galápagos Islands

Explanation;

-Darwin's visit to the Galapagos Islands, helped him discover several species of finches that varied from island to island, which helped him to develop his theory of natural selection. They also helped investigate evolutionary changes in Darwin's finches.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • How does the structure of the stigma aid in pollination ?
    6·1 answer
  • A sustainable business practice called encourages customers to return products to the companies that sold them
    12·1 answer
  • Whistling is considered bad luck among mariners because it challenges the wind. Where did this idea most likely come from?
    15·1 answer
  • First correct answer gets Brainliest! Please answer!
    8·1 answer
  • Which of the following is NOT true about cells? (PLEASE ANSWER ASAP!!)
    6·1 answer
  • I’m the food chain, how much energy is transferred from the sun to a producer
    9·2 answers
  • The Frye and Edidin experiment demonstrated that lateral protein movement within the membrane is affected by
    15·1 answer
  • The use of DNA in the process of classifying organisms is known as.
    6·1 answer
  • Which of the following broad-based field of technical study prepares students for jobs requiring 21st-century knowledge and skil
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!