Ask question

Ask question

All categories

liberstina [14]

2 years ago

14

Centrioles duplicate during the cell cycle. given your knowledge of the cell cycle, when would you guess that the duplication of

centrioles occurs?

1 answer:

mamaluj [8]2 years ago

7 0

The duplication of centrioles occurs at the same time as DNA duplication for the cell cycle; that is, in the S phase of interphase.

You might be interested in

In life cycles that alternate between haploid and diploid stages, ____________ acts to reduce the number of chromosomes per cell

777dan777 [17]

Answer:

meiosis_

fertilization

mitosis

zygote

Explanation:

In life cycles that alternate between haploid and diploid stages, ____meiosis_ acts to reduce the number of chromosomes per cell from two sets to one set. In life cycles that alternate between haploid and diploid stages, ___fertilization__ acts to double the number of chromosome per cell from one set to two sets. In life cycles that alternate between haploid and diploid stages, ______mitosis______ acts to keep the number of chromosomes per cell the same. In animals, a single diploid cell called a ____zygote________ divides by mitosis to give rise to all the cells of the adult body.

3 0

2 years ago

This group of mushrooms, fungi, are growing up through the leaf litter on the forest floor. In any food chain, these fungi would

jekas [21]

These mushrooms and other fungi will be classified as decomposers and they will obtain their nutrition by breaking down the body of organisms that have died. These organisms play a vital role in the cycling of nutrients in a food chain, since they convert the macromolecules present in dead organisms into smaller ones and release them back into the environment.

5 0

2 years ago

Which nitrogen base sequence is the partner of C-A-T-C-G-A?

emmasim [6.3K]

Answer to your question what nitrogen base sequence is paired with CATCGA is
O GTAGCT

6 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

2 years ago

[Intro: Chief Keef]

Igoryamba

Answer:

who is joe?

Explanation:

joe nuts

6 0

2 years ago

Read 2 more answers