Answer:
The correct answer is option a, that is, sympatric speciation.
Explanation:
Speciation, which takes place when two groups of similar species live in a similar geographical location, however, they evolve distinctly unless and until they no longer interbreed and are regarded as different species is termed as sympatric speciation.
Sympatric speciation is not similar to other kinds of speciation, in which the formation of a new species takes place when a population gets differentiated into two groups because of migration or geographic barrier. The sympatric speciation can be witnessed in various distinct kinds of species. Thus, the given case of monkeys is an illustration of sympatric speciation.
I am thinking it is by heating themselves in sunlight. I think this because when I bring lizards to mind, they are cold blooded, and they need sunlight to bath in so they do not start to lack warmth to live.
I hope this helps.
The answer is rain percolates through the pavement into the ground below, causing cracks in the pavemen
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
