1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
r-ruslan [8.4K]
3 years ago
6

Which feature on microscope did Anton van Leeuwenhoek add that enabled him to magnify organisms about 250 times?

Biology
2 answers:
Firdavs [7]3 years ago
7 0

Answer:

polished lenses

                   

                                                 I got it right :D

Sauron [17]3 years ago
3 0

Answer:

D

Explanation:

You might be interested in
Name a structural difference between triglycerides and phospholipids
ipn [44]

Answer:

Phosphate group is the structural difference between triglycerides and phospholipids. A triglyceride contains three fatty acids attached to the glycerol backbone whereas a phospholipid has two fatty acids and a phosphate group attached to the glycerol.

Explanation:

6 0
3 years ago
In fast-twitch oxidative-glycolytic fibers, their rapid increases in force rely on the ________ activity where rapid relaxation
Kitty [74]

Answer:

1. myosin ATPase

2. Ca2+-ATPase

Explanation:

ATPase activity of myosin head hydrolysis ATP and energize the myosin head. The energized myosin head forms cross bridges to facilitate the power stroke of muscle contraction. The fast-twitch oxidative-glycolytic fibers have the ability to produce ATP by aerobic respiration.  

These fibers have the  ATPase in their myosin heads that hydrolyze ATP three to five times faster than the myosin ATPase in slow fibers. This ensures the faster speed of contraction of these fast-twitch muscle fibers.

During their relaxation, Ca2+ ATPase pumps the calcium ions back to the sarcoplasmic reticulum. As the level of Ca2+ ions in the sarcoplasm decreases, calcium ions are released from troponin. Tropomyosin is allowed to cover the myosin-binding sites on actin and the muscle fiber relaxes faster.

4 0
3 years ago
Did the Florida Panther become endangered because of natural selection, genetic drift, or gene flow?
Natalija [7]

Answer:

ALL OF THE ABOVE

Explanation:

Genetic Drift are the changes in allele frequency of a population that result from RANDOM survival or reproduction of individuals with certain characteristics.  Survival or reproduction of those individuals in the face of some environmental change is a matter of LUCK or CHANCE, not because of their phenotype or genotype.

While in Natural selection, the environmental events that affect a population are likely random, but the survival or reproduction of the individuals depends on their phenotypes and genotypes.

Meanwhile, Gene flow is the movement of genes into or out of a population. Low gen flow can lead to low genetic diversity.

Low population which can cause low genetic diversity, poor habitat conditions and habitat loss, road deaths, and commercial development in panther range are constant threats to the Florida Panther's survival.

All these causes are related and therefore affects the Florida Panther.

7 0
3 years ago
The number of zebras in the zoo is considered a
Delicious77 [7]
If you're referring to what a group of zebras is called. Its very interesting, a group of zebras is called a Dazzle or a Zeal!
6 0
3 years ago
Read 2 more answers
Animals that change greatly as they mature are said to undergo _____. metamorphosis transformation transmutation alteration
Kruka [31]
The answer is metamorphosis.
3 0
3 years ago
Read 2 more answers
Other questions:
  • "a supertype can have only one subtype. true or false
    13·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • ________ is the most abundant and widely distributed tissue type in the body.
    5·1 answer
  • What are organic compound needed for living things
    7·1 answer
  • Some scientists theorize that this behavior developed from the tactic of throwing smaller eggs to break them open. ostrich eggs,
    9·1 answer
  • Can someone help me 5 and 6 plz
    9·2 answers
  • 4. What are carbon dioxide levels now? How often in the past 650,000 years have they been that high?
    5·1 answer
  • Please help will give brainliest
    11·1 answer
  • Explain why temperature changes occur. <br> plz help
    6·1 answer
  • Why cell known as structural and functional unit of life.​
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!