1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scZoUnD [109]
3 years ago
6

The basic function of the pulmonary​ system, known as​ "ventilation," refers to​ what?

Biology
1 answer:
Sidana [21]3 years ago
8 0
Hi the answer to your question is it refers to the movement of air in and out of the lungs.
Hope this helps you.
You might be interested in
What is net force on each item? Type in the number and select the direction from the units.
mel-nik [20]

Answer:

Explanation: the image on the left is 4up and the image on the right is 2 right

6 0
2 years ago
Which of the following is the best example of one
swat32

Answer:

D.

Explanation:

Plants take in CO2 and turn into Carbo.

That's the most efficient example

8 0
3 years ago
An individual has a genotype of IBi. What is their blood type?
abruzzese [7]

Answer:

type B

.................

4 0
2 years ago
Which cellular structure do organisms in the kingdoms Eubacteria, Archaebacteria, and Protista have in common?
liberstina [14]

Answer:

I believe the answer is B.

Explanation:

Hope my answer has helped you and if not i am sorry.

8 0
3 years ago
Which phrase describes the way air particles vibrate with respect to the way a sound wave travels?
Nezavi [6.7K]
The answer will be C
8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is not a phase of mitosis?
    11·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Is the cell membrane in bacteria?
    7·2 answers
  • Carrying capacity is blank
    5·1 answer
  • 12. What do archaea look like?
    7·2 answers
  • Order the process of nuclear fusion, beginning with the first step on top and ending with the last step on the bottom. Drag answ
    6·1 answer
  • Why can’t the evolutionary relationships between certain species be explained thoroughly?
    5·1 answer
  • What is one positive thing that can happen after a hurricane?
    10·2 answers
  • What is the main trend shown in the graph?
    12·1 answer
  • Hello people ~
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!