3 years ago

Evolution is:

1 answer:

3 0

A, b, and c are all correct.

take for example finches off of the galapagos islands. they vary from island to island, yet are still the same bird. on one island they have bigger, more durable and stronger beaks, because that island has many nuts to crack open and eat. on another island, they have thin ling beaks, ideal for pecking at insects in the grass on tree bark. evolution is literally survival of the ifttest, where those equipped best will live and those without means to fight for life will die off, leaving those most capable of reproduction and passing down genes.

You might be interested in

Which of these statements about light microscopes and electron microscopes is NOT true?

Varvara68 [4.7K]

I believe your answer is B, Because electrons are clinched to protons, most times, therefor there is not an electron microscope, but a ELECTRONIC Microscope will show the organism on a screen. hope that helped some<span />

8 0

3 years ago

Explain why oxygen and carbon dioxide diffuse in opposite directions in the lungs?

Vilka [71]

Answer:

There is a higher oxygen content in the air of the lungs than that of oxygen-depleted blood and a lower carbon dioxide concentration. This gradient of concentration causes gas exchange during respiration.

Explanation:

8 0

3 years ago

Type of response in which physical reactions result from stress

Serjik [45]

The answer is Chronic<span> Stress</span>

8 0

3 years ago

Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:

Kryger [21]

agcgggaugagcgcauguggcgcauaacug

4 0

3 years ago

A scientist observes that a certain trait is determined by a single gene.

tangare [24]

Answer:

Codominance

Explanation:

Codominance occurs when both alleles participation in the expression of the genotype of an offspring, such as a flower with patches of different colours, each coming from a different allele.

7 0

3 years ago