1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Roman55 [17]
3 years ago
12

Which changing external condition triggers the salivary glands?

Biology
1 answer:
gregori [183]3 years ago
8 0
<span>The correct answer is B. Lack of water. When there's no water and you start to dehydrate, your salivary glands start working extra hard because your mouth can't be dry and the salivary glands produce saliva to keep the mouth and the throat dry. If your throat and mouth are dry you can't even swallow.</span>
You might be interested in
Do you think mouse offspring will always look like their parents? ______________________
almond37 [142]

Not always because there could be birth defects, mutations, or other variables.

7 0
3 years ago
What best describes the purpose of technology
fenix001 [56]
The creative use of science to solve problems.
8 0
3 years ago
What type of plants can reproduce through seeds?​
valentinak56 [21]

Most plants grow from seeds. These seed plants fall into two groups, <u>angiosperms</u> and <u>gymnosperms</u>.

hope this helps ^^

5 0
3 years ago
How do scientists know when life began?
Ronch [10]
Scientists so far haven’t managed to figure that out .
4 0
3 years ago
Which of the following is not a characteristic of an industrial society?
torisob [31]

Answer:

A

Explanation:

3 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • What is required for heat transfer using conduction? A. Light B.Contact C.Fire D.Waves
    6·1 answer
  • What term do scientists use to describe all the different forms of life on earth
    7·1 answer
  • Why do plants have a greater disadvantage in unpredictable environments than animals?
    11·2 answers
  • 7. In a free market economy, decisions are made according to the laws of
    13·2 answers
  • Which adaptation would be most useful to an insert that lives in grass
    9·2 answers
  • What affects the rate of diffusion​
    12·1 answer
  • 4. People who always feel positive in every effort in order to achieve
    10·2 answers
  • Describe the role of the double fertilisation in angiosperm reproduction
    7·1 answer
  • What is a mixture and why is the air we breathe a mixture?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!