1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
8090 [49]
3 years ago
12

A newly formed lake is most likely _____.

Biology
2 answers:
blsea [12.9K]3 years ago
5 0

Answer: oligotrophic

Explanation:

A newly formed lake is most likely to be oligotrophic. The oligotrophic lake is expected to have high oxygen concentration in water and low organic and inorganic nutrient content. This condition can only support the growth of small number of plants and algae. The overall growth rate of flora and fauna will be low hence, the biodiversity of a region will be low.

Nimfa-mama [501]3 years ago
4 0

Answer:The answer is oligotrophic hope this help

Explanation:

You might be interested in
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
2 years ago
Earths four major spheres are the?
aleksklad [387]

Everything in Earth's system can be placed into one of four major subsystems: land, water, living things, or air. These four subsystems are called “spheres.” Specifically, they are the lithosphere (land), hydrosphere (water), biosphere (living things), and atmosphere (air)...

I hope this helps you with biology...


---nila---

7 0
3 years ago
Read 2 more answers
Organisms in an ecosystem are interdependent. do you think humans have interdependent relationships with other organisms? explai
jeka94

Humans have an interdependent relationship with other organisms just like organisms in an ecosystem are interdependent.

<h3>How are organisms interdependent?</h3>

To be interdependent means that the involved parties are mutually dependent i.e. they are reliant on one another.

Living organisms in their natural habitat are dependent on one another for food, space, mate and other resources.

However, humans are also interdependent on other organisms for resources like food, raw materials. For example, we eat plant and flesh derived from other organisms.

Learn more about interdependence at: brainly.com/question/1530206

#SPJ4

6 0
2 years ago
If you drink a gallon or more of fresh water at a single sitting, what happens to your blood and then what might happen to the c
Tomtit [17]

Answer:

I hope this will help

Explanation:

When you drink too much water, your kidneys can't get rid of the excess water. The sodium content of your blood becomes diluted. This is called hyponatremia and it can be life-threatening.

Hyponatremia is a low sodium concentration in the blood. It is generally defined as a sodium concentration of less than 135 mmol/L (135 mEq/L), with severe hyponatremia being below 120 mEq/L. Symptoms can be absent, mild or severe. Mild symptoms include a decreased ability to think, headaches, nausea, and poor balance.

8 0
3 years ago
Read 2 more answers
Which of the following organelles assembles proteins? ribosomes Golgi apparatus nuclear envelope or endoplasmic reticulum
Artist 52 [7]

The right answer is Ribosomes

The ribosome is a complex composed of RNA and ribosomal proteins, associated with a membrane (in the granular endoplasmic reticulum) or free in the cytoplasm. Common to all cells (prokaryotes and eukaryotes), the ribosome (and especially its composition) varies according to the organisms, even if it is always composed of two distinct subunits.

The ribosome is a huge ribonucleoprotein complex that allows the translation of mRNAs into proteins.

5 0
3 years ago
Read 2 more answers
Other questions:
  • The integumentary system is an organ system consisting of the skin, hair, nails, exocrine glands, and sensory nerves. What is mo
    5·1 answer
  • Which of the following does not occur in prophase I of meiosis
    8·1 answer
  • The tongue is covered with hairlike projections called
    6·1 answer
  • What happens to RNA polymerase II after it has completed transcription of a gene? a. It begins transcribing the next gene on the
    8·1 answer
  • Nuclei of atoms that make up a newborn baby were made in the
    8·1 answer
  • The process of cellular respiration begins with molecules of _______ and ends with the production of _______.
    15·2 answers
  • PLEASE HELP ME BEFORE I DROP OUT OF HIGH SCHOOL
    14·2 answers
  • Tugma Ng<br><br>Adhikain<br><br>Pighati<br><br>Kalasag<br><br>Pandemya<br><br>Magbuwis​
    11·1 answer
  • What is the carrying capacity (approx)?
    6·1 answer
  • What term(s) best describes enzymes? <br> O lipids<br> proteins<br> catalysts<br> both b and c
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!