1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zaharov [31]
3 years ago
13

______ separating lanes means changing lanes is illegal ?

Biology
2 answers:
AveGali [126]3 years ago
8 0
When there are double lines in the lanes means you can not change lanes.. only when there is breaks in the lines can you change lanes
Aleks04 [339]3 years ago
8 0
The answer is two double white lines.
You might be interested in
Why adaption is important​
aleksklad [387]

Answer:

Adaptation is important for not only animals but humans to survive. If either living things habitat change they must change with it to survive.

8 0
3 years ago
100 POINTS! AND GIVE EXPLANATION!
kobusy [5.1K]

Answer:

CO₂

Explanation:

In chemistry we use subscripts after the element represented by that amount.

7 0
3 years ago
Read 2 more answers
Malarial parasite is ? kinds of parasite
yawa3891 [41]
Malarial parasites are caused by Plasmodium parasites, these parasites infect humans via the bite of infected Anopheles mosquitoes. Some of these mosquitos are Plasmodium vivax, P. falciparum, <span>P. ovale, and P. malariae</span>
7 0
3 years ago
Bruce has a genetic disorder. bruce and his wife, kim, have three children, one of which has the genetic disorder. how is this d
laiz [17]
This would be a recessive disease.

Father is dd
Mother is Dd (has to be because one child has the disease)

Parents cross is dd x Dd which gives rise to Dd (0.5) and dd (0.5). Each time they have a child they have a 50% chance of the child having the disease. In their case, only one of their 3 children is dd. The others though are carriers!
5 0
3 years ago
What makes some people prefer hot and spicy foods, while others may sweets?
Andreyy89
Upbringing and habit
8 0
3 years ago
Other questions:
  • Which statement describes why natural populations cannot keep growing exponentially?
    7·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • The table shows the nature of reactants and products formed in a certain type of chemical reaction.
    5·1 answer
  • Which example is not an organism? <br><br>bacteria<br><br>lung<br><br>mold<br><br>human​
    9·1 answer
  • What is the chromosomal number of humans, monkeys, dogs, corn, chicken and peas?
    12·1 answer
  • Would a cell that did not undergo cytokinesis be able to function properly? Explain.
    15·1 answer
  • Which of the following statements about plankton or nekton is NOT correct?
    14·1 answer
  • A certain genetic mutation is found with a high frequency in populations of humans living in places that experienced a deadly di
    5·1 answer
  • please help ill give brainliest :)) A car travels a distance of 385 km in 8 hours. At what speed did it travel?
    8·2 answers
  • Define nutrient and thermal pollution.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!