1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yarga [219]
3 years ago
7

Mindy was just arrested for driving while intoxicated (dwi). why would we not necessarily diagnose mindy with an alcohol use dis

order?
a. intoxication is not pathological.
b. dsm requires a recurrent pattern of problematic use.
c. dsm excludes dwi as a criterion for alcohol use disorder.
d. she is female, and alcohol use disorder is only seen in males.
Biology
1 answer:
Bond [772]3 years ago
8 0
Based solely on the situation given, the most correct answer is (b) DSM requires a recurrent pattern of problematic use. DSM<span>-IV Criteria for </span>Alcohol<span> Abuse states that "</span>alcohol<span> abuse" should be manifested by plenty of factors, including: RECURRING </span>alcohol<span>-related legal problems.</span>
You might be interested in
Define the components of blood and briefly describe their role.
Grace [21]
Tha main components in blood are the plasma, red blood cells, white blood cells, and blood platelets.

Plasma is like the main component that makes up most of the blood. It has a light yellow color and it carries many substances including nutrients, waste, hormones and more.

Red blood cells are the reason why blood is red in color. They have a hemoglobin inside them which can help carry oxygen for the tissues and organs. In order to maximize the oxygen carrying capacity, they don't have a nucleus.

White blood cells can be divided into phagocytes and lymphocytes. Their main function is to protect us from diseases. Phahocytes and engulf and digest bacteria, while lymphocytes can produce antibodies.

Blood platelets can cause blood clotting which can stop us from bleeding forever. They're not cells, but just fragments of cells. They also don't have nucleus since they're not complete cells.
8 0
3 years ago
____________ is translated by the ribosomes and contains the code that specifies the sequence of amino acids in a polypeptide ch
HACTEHA [7]

mRNA (Messenger RNA) is translated by ribosomes and contains the code that specifies the sequence of amino acids in polypeptide chain.

A single-stranded ribonucleic acid molecule is known as messenger RNA(mRNA) plays a major role in <u>translation</u>.

Translation is the method by which an mRNA codes for a certain protein. mRNA provides the template for<u> protein synthesis</u>.

The ribosome translates the mRNA that is produced from the DNA into a chain of certain amino acids and<u> protein synthesis</u> is facilitated by this <u>amino acid</u> sequence.

<u>The genetic code</u>, which connects the DNA sequence to the amino acid sequence of proteins, is used to "read" the mRNA. Each group of three nucleotides in mRNA forms a codon, and each codon corresponds to a particular amino acid (triplet code).

Thus mRNA contains the code that specifies the<u> sequence of amino acids</u> in a polypeptide chain.

Learn more about different type of RNA here brainly.com/question/21177344

#SPJ4

4 0
2 years ago
the galapagos tortoise are biodiverse. tortoises in a more barren area have a flat shell and long neck to help grasp the sparse
natima [27]

Answer:

<em>This is an example of natural selection (adaptation).</em>

Explanation:

Natural selection tends to favor those organisms which are better adapted to live in an environment.

As tortoises having flat shell and long neck were better adapted to live in barren area, hence through natural selection those organisms were favored in such an ecosystem.

As tortoises that lived on the vegetative lands were more adapted to live in such an ecosystem, hence through natural ecosystem these organisms were favored and increased in numbers.

8 0
3 years ago
Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought
AfilCa [17]
The correct option is A.
Living organisms depend on their environment to survive, when there are changes in the environment which are not favorable to the living organisms, it will eventually leads to the wiping out of the living organisms. As time goes on and the environment recover, the living organisms that will be found in the new environment are those who will be able to survive in it.
4 0
3 years ago
Read 2 more answers
Cual es la diferencia entre la cantidad de CO2 en el ambiente y en nuestros pulmones
MatroZZZ [7]
Mrmekrkrkrkrkrkrkrkrkrrkrkkekedjdjdjdkdkd
6 0
3 years ago
Other questions:
  • Please help ASAP!
    13·1 answer
  • Why does the phylogenetic tree tell you about the evolutionary relationships of animals?
    12·2 answers
  • How does Propionibacterium acnes cause acne in humans?
    11·1 answer
  • Drag and drop the terms on the left to complete the concept map
    15·2 answers
  • ( I really need help on this)A compound microscope uses
    10·1 answer
  • How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
    5·1 answer
  • All living cells come from pre-existing cells by division<br> True<br> False
    8·2 answers
  • When was the term acid rain first used?<br><br> 1960<br><br> 1753<br><br> 1980<br><br> 1852
    11·1 answer
  • What structure encloses almost all bacteria? Do bacteria have a structure that encloses the genetic material?
    5·1 answer
  • Which diagram best illustrates the flow of energy in an ecosystem?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!