1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andrej [43]
3 years ago
15

The only function of the skeletal system is to provide the body with a framework. True or False

Biology
1 answer:
Alexxx [7]3 years ago
4 0
<span>The skeletal system in the body provides the shape, supports and protects organs and the soft areas of the body. Its also provides movement, produces blood for the body, and stores minerals that a human needs. So it is not only to provide the body with framework. It is much more.
</span>Hope this helps. 
You might be interested in
Facts about the egg stage of a bird
zimovet [89]
I thinks its Berthe fly
3 0
3 years ago
Which term describes the release of eggs from the ovary?
Step2247 [10]
Ovulation is the process in which eggs are released from the ovary.
6 0
4 years ago
Read 2 more answers
What is the significant difference between chimpanzees and humans that accounts for the divergence between the two species in ar
seraphim [82]

Answer:

speech

Explanation:

humans and chimpanzees are different mainly on the significant difference on being able to use speech by humans and not used by chimpanzees. Moreover, humans have such a powerful brain and which provides logics that enable them to carry out more works than any other of their species.

6 0
3 years ago
C ultra violet <br> ultra violet rays are impossible to see by the humans naked eye
viva [34]
"By definition, ultraviolet light<span> is 'beyond violet </span>light<span>' and the visible spectrum that </span>can <span>be detected by the human eye. It cannot, therefore, </span>be seen<span> directly. Detectors that are sensitive to </span>UV<span> convert it into a form that we </span>can see<span>. ... In this scenario, however, </span>UV light<span> is being emitted, not received" found this on google hope it is helpful. </span>
3 0
4 years ago
Erythrocytes might the best of example of form equals function because they lack many organelles. What organelles are absent in
borishaifa [10]
Mature mammalian red blood cells lack nuclei, mitochondria and rough endoplasmic reticulum, they do not contain DNA and consequently, cannot divide. They also cannot synthesise RNA nor synthesise any new proteins, and consequently, have a limited lifespan. Mature red blood cells circulate for about 100–120 days in the body before they are removed by the spleen.

Hope this helps
8 0
3 years ago
Other questions:
  • Which of the following best summarizes how hormone levels are controlled?
    7·1 answer
  • How did the Miller-Urey experiment impact the way scientists think about the origins of life?
    15·1 answer
  • Marijuana smoke contains some of the same harmful chemicals found in tobacco smoke. true or false
    14·1 answer
  • Plant pollen found in sediment layers can provide scientists with information on how the Earth's climate has changed over time t
    14·1 answer
  • The daughter-producing sperm used to fertilize brittany's eggs should be
    13·1 answer
  • Which of these most likely causes a lunar eclipse?
    13·2 answers
  • How is detritus important to wetland ecosystems?
    10·2 answers
  • AUUUAACUGUUCUGUCUAGAG
    6·1 answer
  • Some plants lose their leaves and go dormant during hot, dry summers. What happens to these plants' life processes during dorman
    13·1 answer
  • NADPH is made by Question 37 options: a) the Krebs cycle. b) chemiosmosis. c) glycolysis. d) the passing of electrons from photo
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!