1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
user100 [1]
3 years ago
13

What type of organism makes up the oldest known fossil?

Biology
1 answer:
choli [55]3 years ago
8 0
Blue-green algae from South Africa at 3.2 billion years old.
You might be interested in
What are three characteristics that make life possible on Earth?
lilavasa [31]

Different characteristics such as Earth's atmosphere, distance from the Sun, and presence of water make life on Earth possible.

<h3>Is there a groups of rules for organisms to live?</h3>

The idea that there is a group of rules to support life on Earth is controversial but it is clear that life as we know required different features to form.

Some of the most important features that support the emergence of biologically closed systems on Earth include the presence of water in a liquid state, an appropriate atmosphere and a suitable amount of solar radiation.

In conclusion, different characteristics such as Earth's atmosphere, distance from the Sun, and presence of water make life on Earth possible.

Learn more about life on Earth here:

brainly.com/question/23140994

#SPJ1

8 0
2 years ago
Extrusions are formed by cooling magma beneath Earth's surface.
miv72 [106K]
False

I took the test.
8 0
3 years ago
Read 2 more answers
The brain injury suffered by 19th-century railroad worker phineas gage allowed psychologists to learn about the functions of the
monitta
The brain injury suffered by Phineas allowed psychologists to learn about the functions of the brain's FRONTAL LOBE.
The man case was the first one in which a brain damage will result into a change in personality. The damage to the Phineas frontal lobe helped scientists to recognize the connection between the frontal lobe of the brain and social cognition and decision making.<span />
7 0
3 years ago
Which of the following codons code for threonine?
nordsb [41]
The answer is C.... ACA
3 0
3 years ago
What is an ecological niche?​
Yuri [45]

Answer:

"Ecological niche is a term for the position of a species within an ecosystem, describing both the range of conditions necessary for persistence of the species, and its ecological role in the ecosystem."

Explanation:

sources: sciencedirect

7 0
3 years ago
Read 2 more answers
Other questions:
  • Where does cellular respiration take place in the cell?
    12·1 answer
  • When using data from population genetics research:
    8·2 answers
  • When organisms ingest food, the food is converted into which substance?
    10·1 answer
  • Describe one function of the seeds produced by plants
    8·2 answers
  • Rational design requires:
    13·2 answers
  • I need help please! This is a question on genetics!
    13·1 answer
  • PLEASE HELP ME ILL MARK BRAINLIEST CORRECT ANSWer thank you
    8·1 answer
  • Next, count the number of wooden frames that fill the
    7·1 answer
  • Persistence length for a cytoskeletal filament is the minimum filament length at which random thermal fluctuations are likely to
    11·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!